Exhibit 10.1
***Text Omitted and Filed Separately
Confidential Treatment Requested
Under 17 C.F.R. (S)(S) 200.80(b)(4),
200.83 and 240.24b-2
COLLABORATIVE DEVELOPMENT AND MARKETING AGREEMENT
Collaborative Development and Marketing Agreement
TABLE OF CONTENTS
-----------------
Page No.
1. Definitions ............................................................................. 1
1.1 Additional Product ................................................................ 1
1.2 BLA ............................................................................... 1
1.3 cGMP .............................................................................. 1
1.4 Clinical Plan ..................................................................... 1
1.5 Clinical Program .................................................................. 2
1.6 Clinical Supply ................................................................... 2
1.7 Clinical Trial .................................................................... 2
1.8 Clinical Trial Costs .............................................................. 2
1.9 Collaboration Invention ........................................................... 2
1.10 Collaboration Invention Patent Rights ............................................. 3
1.11 Commercial Supply ................................................................. 3
1.12 Commercially Reasonable and Diligent Efforts ...................................... 3
1.13 Commercialization Plan ............................................................ 3
1.14 Completion of Phase II (or Phase III) Clinical Trials ............................. 3
1.15 Confidential Information .......................................................... 3
1.16 Controlled ........................................................................ 3
1.17 Covering .......................................................................... 3
1.18 DENDREON/GNE Development Costs .................................................... 3
1.19 Dendreon Know-how ................................................................. 4
1.20 Dendreon Patents Rights ........................................................... 4
1.21 Dendreon Territory ................................................................ 4
1.22 Development Research .............................................................. 4
1.23 Discovery Research ................................................................ 4
1.24 Effective Date .................................................................... 4
1.25 FDA ............................................................................... 4
1.26 Field ............................................................................. 4
1.27 FTE ............................................................................... 4
1.28 FTE Costs ......................................................................... 5
1.29 Genentech Know-how ................................................................ 5
1.30 Genentech Patent Rights ........................................................... 5
1.31 IND ............................................................................... 5
1.32 Joint Project Team or JPT ......................................................... 5
1.33 Joint Steering Committee .......................................................... 5
1.34 Joint Collaboration Invention ..................................................... 5
1.35 Joint Patent Rights ............................................................... 5
1.36 Know-how .......................................................................... 5
1.37 Licensed Product .................................................................. 5
1.38 Licensed Trp-p8 Vaccine Product ................................................... 6
1.39 Manufacturing Know-how ............................................................ 6
1.40 Monoclonal Antibody ............................................................... 6
1.41 Monoclonal Product ................................................................ 6
1.42 NDA ............................................................................... 6
1.43 Net Sales ......................................................................... 6
1.44 Operating Profits and Losses ...................................................... 7
1.45 Other Molecule .................................................................... 7
1.46 Party or Parties .................................................................. 7
1.47 Patent Rights ..................................................................... 7
1.48 Permitted Assignee ................................................................ 7
1.49 Phase I Clinical Trial ............................................................ 7
1.50 Phase II Clinical Trial ........................................................... 7
1.51 Phase III Clinical Trial .......................................................... 7
1.52 Pivotal Trial ..................................................................... 8
1.53 Preclinical Plan .................................................................. 8
1.54 Preclinical Program ............................................................... 8
1.55 Preclinical Program Costs ......................................................... 8
1.56 Prevalent Cancer .................................................................. 8
1.57 Product Development Program ....................................................... 8
1.58 Regulatory Agency ................................................................. 8
1.59 Regulatory Approval ............................................................... 8
1.60 Regulatory Filings ................................................................ 8
1.61 Research Grade Material ........................................................... 8
1.62 SM Product ........................................................................ 8
1.63 Small Molecule .................................................................... 9
1.64 Term .............................................................................. 9
1.65 Territory ......................................................................... 9
1.66 Third Party ....................................................................... 9
1.67 Third Party Costs ................................................................. 9
1.68 Trp-p8 ............................................................................ 9
1.69 Tumor Type ........................................................................ 9
1.70 Vaccine Product Patent Rights ..................................................... 9
1.71 Valid Claim ....................................................................... 9
2. Scope of the Product Development Program ................................................ 9
2.1 Product Development Program ....................................................... 9
2.2 Preclinical Program ............................................................... 10
2.3 Monoclonal Product ................................................................ 10
2.3.1 Genentech Responsibilities .................................................. 10
2.3.2 Dendreon Independent Activities ............................................. 11
2.4 Decision Point - Monoclonal Product ............................................... 11
2.5 SM Product ........................................................................ 11
2.5.1 Dendreon Responsibilities ................................................... 11
2.5.2 Genentech Independent Activities ............................................ 12
2.5.3 JSC Decision ................................................................ 12
2.5.4 Small Molecule Agreements ................................................... 12
2.6 Genentech Option for SM Products .................................................. 13
2.6.1 Exclusive Option ............................................................ 13
2.6.2 Exercise of Option .......................................................... 13
2.6.3 Early Exercise .............................................................. 14
2.7 Licensed Trp-p8 Vaccine Products .................................................. 14
2.7.1 Vaccine Products ............................................................ 14
2.7.2 Genentech First Right of Negotiation ........................................ 14
2.8 Preclinical Program Costs ......................................................... 15
2.8.1 Genentech Costs ............................................................. 15
2.8.2 Dendreon Costs .............................................................. 15
2.8.3 Payment for Independent Activities .......................................... 16
2.9 Clinical Program .................................................................. 16
2.10 Phase I and Phase II Responsibilities ............................................. 17
2.11 Phase II Decision Point ........................................................... 17
2.12 Phase I and II Clinical Trial Costs ............................................... 18
2.13 Phase III Clinical Trials ......................................................... 19
2.14 SM Product and Monoclonal Product Cost Sharing .................................... 19
2.15 First Monoclonal Product Phase III Results ........................................ 20
2.16 First SM Products Phase III Results ............................................... 20
2.17 Additional Products and Other Molecules ........................................... 20
2.18 Regulatory Filings, Communications and Reports .................................... 20
2.18.1 Rights and Obligations of Dendreon ......................................... 20
2.18.2 Regulatory Filings for Manufacturing ....................................... 21
2.18.3 Cross Reference of Regulatory Filings ...................................... 22
2.18.4 Regulatory Meetings and Communications ..................................... 22
2.19 Information ....................................................................... 22
2.20 Adverse Drug Events and Complaints ................................................ 23
2.21 Other Activities .................................................................. 23
2.22 Transfer of Materials ............................................................. 24
2.23 Thirty Party Academic Researchers/Institutions .................................... 24
2.24 Contracts with Third Parties ...................................................... 25
3. Joint Steering Committee ................................................................ 25
3.1 Joint Steering Committee .......................................................... 25
3.2 JSC Meetings ...................................................................... 26
3.2.1 Meeting Schedule ............................................................ 26
3.2.2 JSC Chair ................................................................... 26
3.3 Decision-Making and Issue Resolution .............................................. 26
4. Joint Project Team ...................................................................... 27
4.1 Establishment of Joint Project Team ............................................... 27
4.2 Joint Project Team Responsibilities ............................................... 27
4.3 Joint Project Team Decision-making ................................................ 28
4.4 Ceasing of Joint Project Team Operations .......................................... 28
4.5 Annual Production Requirements .................................................... 28
5. Licenses and Rights ..................................................................... 28
5.1 Dendreon Grant .................................................................... 28
5.2 Genentech Grant ................................................................... 29
5.3 Dendreon Sublicense Rights ........................................................ 30
5.4 Genentech Sublicense Rights ....................................................... 30
5.5 Sublicense Obligations ............................................................ 30
5.6 Trademark License ................................................................. 31
5.7 Exclusions ........................................................................ 31
6. Payments ................................................................................ 31
6.1 Equity Investment ................................................................. 31
6.2 Additional Equity Investment ...................................................... 31
6.3 Monoclonal Product Milestones ..................................................... 31
6.4 SM Product ........................................................................ 33
6.5 Royalties to Dendreon ............................................................. 34
6.6 Royalties to Genentech ............................................................ 34
6.7 Currency and Payments ............................................................. 34
6.8 Royalty Reports ................................................................... 34
6.9 Books and Records ................................................................. 35
6.10 Audit Rights ...................................................................... 35
6.11 Blocked Currency .................................................................. 35
6.12 Taxes ............................................................................. 35
7. Commercialization in the Territory ...................................................... 35
7.1 Commercialization - General Roles ................................................. 35
7.2 Marketing and Sales by Dendreon ................................................... 36
7.3 Option to Co-Promote Competing Products ........................................... 37
7.4 Commercialization Plans ........................................................... 37
7.5 Commercialization Efforts ......................................................... 37
7.6 Additional Genentech Responsibilities ............................................. 38
7.7 Commercialization Costs ........................................................... 38
7.8 Trademarks and Domain Names ....................................................... 38
7.8.1 Single Product Trademarks ................................................... 38
7.8.2 Acknowledgment of Ownership Rights .......................................... 38
7.8.3 Use of Trademark Designations ............................................... 39
7.8.4 Infringement of Product Trademarks .......................................... 39
7.9 Manufacture and Supply ............................................................ 39
7.9.1 Clinical Supply ............................................................. 39
7.9.2 Clinical Supply for Monoclonal Antibodies ................................... 39
7.9.3 Commercial Supplies ......................................................... 40
8. Inventions and Infringement ............................................................. 40
8.1 Inventorship and Ownership ........................................................ 40
8.1.1 Inventorship ................................................................ 40
8.1.2 Collaboration Invention Patents ............................................. 41
8.2 Restrictions on Jointly-Owned Inventions .......................................... 41
8.3 Prosecution and Maintenance of Genentech Patent Rights, Dendreon Patent
Rights and Vaccine Product Patent Rights .......................................... 41
8.4 Prosecution and Maintenance of Collaboration Patent Rights ........................ 41
8.4.1 Coordination ................................................................ 41
8.4.2 Outside Counsel ............................................................. 42
8.4.3 SM Products ................................................................. 42
8.4.4 Abandonment ................................................................. 42
8.5 Patent Interferences .............................................................. 43
8.6 Patent Enforcement ................................................................ 43
8.6.1 Notice ...................................................................... 43
8.6.2 Enforcement of Genentech Patent Rights, Dendreon Patent Rights and
Vaccine Product Patent Rights ............................................... 43
8.6.3 Enforcement of Collaboration Invention Patent rights ........................ 43
8.6.4 Collaboration Invention Patent Rights related to Small Molecules or SM
Licensed Product ............................................................ 44
8.6.5 Initiating Party ............................................................ 44
8.6.6 Prosecution ................................................................. 44
8.7 Defense of Claim of Infringement .................................................. 45
8.7.1 Third Party Claims .......................................................... 45
8.7.2 Defense of Claims ........................................................... 45
8.8 Third Party Patents and Royalties ................................................. 45
9. Representation, Warranties and Indemnities .............................................. 46
9.1 Dendreon's Representations and Warranties ......................................... 46
9.2 Genentech's Representations and Warranties ........................................ 46
9.3 Disclaimers ....................................................................... 47
9.4 Except As Expressly Set Forth Herein Each Party Disclaims ......................... 47
9.5 Dendreon's Indemnities ............................................................ 47
9.6 Genentech's Indemnities ........................................................... 48
9.7 Indemnity Conditions .............................................................. 48
9.8 Insurance ......................................................................... 49
9.9 Uninsured Losses .................................................................. 49
10. Term and Termination .................................................................... 49
10.1 Term .............................................................................. 49
10.2 Term of Licenses to Dendreon and Royalties to Genentech ........................... 50
10.3 Early Termination for Product Failure ............................................. 50
10.4 Early Termination by Genentech without Cause ...................................... 50
10.4.1 Termination Following Phase II Clinical Trial .............................. 50
10.4.2 Termination Following Phase III Clinical Trial ............................. 51
10.5 Termination for Cause ............................................................. 53
10.5.1 Material Breach ............................................................ 53
10.5.2 Bankruptcy ................................................................. 53
10.6 Effect of Termination for Cause Under Section 10.5 ................................ 53
10.6.1 Termination by Genentech ................................................... 53
10.6.2 Termination by Dendreon .................................................... 54
10.7 No Limitation ..................................................................... 55
10.8 Survival .......................................................................... 55
10.9 Bankruptcy ........................................................................ 55
10.10 Effect of Expiration or Termination on Intellectual Property ...................... 55
11. Confidentiality; Use of Names ........................................................... 56
11.1 Confidential Information .......................................................... 56
11.2 Exceptions ........................................................................ 56
11.3 Permitted Disclosure .............................................................. 56
11.4 Term of Confidentiality ........................................................... 56
11.5 Return of Information ............................................................. 57
11.6 Press Releases and Announcements .................................................. 57
11.7 Scientific Publications and Presentations ......................................... 57
12. General Provisions ...................................................................... 57
12.1 Future Acts ....................................................................... 57
12.2 Independent Contractors ........................................................... 57
12.3 Assignment ........................................................................ 58
12.4 Waiver ............................................................................ 59
12.5 Force Majeure ..................................................................... 59
12.6 Severability ...................................................................... 59
12.7 Headings .......................................................................... 60
12.8 Legal Counsel ..................................................................... 60
12.9 Dispute Resolution and Governing Law .............................................. 60
12.9.1 Disputes ................................................................... 60
12.9.2 Arbitration ................................................................ 60
12.9.3 Determination of Patents and Other Intellectual Property ................... 61
12.9.4 Governing Law .............................................................. 61
12.10 Notices ........................................................................... 61
12.11 Amendment ......................................................................... 61
12.12 Entire Agreement .................................................................. 61
12.13 Counterparts ...................................................................... 62
EXHIBIT A Trp-p8
EXHIBIT B Financial Planning, Accounting and Reporting
EXHIBIT C Itakura/▇▇▇▇▇ Patents
EXHIBIT D Equity Investment Agreement
***Text Omitted and Filed Separately
Confidential Treatment Requested
Under 17 C.F.R.(S)(S)200.80(b)(4),
200.83 and 240.24b-2
Collaborative Development and Marketing Agreement
This Collaborative Development and Marketing Agreement (the
"Agreement") is entered into as of August 1, 2002 by and between Dendreon
Corporation, ▇▇▇▇ ▇▇▇▇▇ ▇▇▇▇▇▇, ▇▇▇▇▇▇▇, ▇▇▇▇▇▇▇▇▇▇ ▇▇▇▇▇, a Delaware
corporation ("Dendreon") and Genentech, Inc., ▇ ▇▇▇ ▇▇▇, ▇▇▇▇▇ ▇▇▇ ▇▇▇▇▇▇▇▇▇,
▇▇▇▇▇▇▇▇▇▇ ▇▇▇▇▇, a Delaware corporation ("Genentech").
Preliminary Statement
A. Dendreon is engaged in the development of immunotherapies for the
treatment of cancers and owns certain rights to a molecule referred
to as Trp-p8.
B. Genentech possesses resources and capabilities for the clinical
development, marketing, and manufacturing of therapeutic biologic
and drug products.
C. The Parties believe that properties of Trp-p8 make it a viable
target candidate for therapeutic monoclonal antibodies, small
molecules, and other therapeutic molecules and therapeutic vaccines.
D. Dendreon and Genentech desire to collaborate in the development,
clinical testing and commercialization of such monoclonal
antibodies, small molecules, and other molecules and therapeutic
vaccines directed to Trp-p8 on the terms and conditions set forth in
this Agreement.
Now, therefore, the Parties agree as follows:
Agreement
1. Definitions. The following terms shall have the following meanings in
this Agreement:
1.1 "Additional Product" means a Licensed Product that is being
developed by Dendreon and Genentech in the United States for a
different Tumor Type than that Tumor Type for which such
Licensed Product: (a) is already being developed by the Parties
hereunder or (b) has already been developed by the Parties and
has received Regulatory Approval for sale in the United States.
1.2 "BLA" means a Biologics License Application made to obtain
approval from the FDA for commercial sale of a Licensed Product.
1.3 "cGMP" means the regulatory requirements as in effect from time
to time for current good manufacturing practices as promulgated
by the FDA under the U.S. Food, Drug and Cosmetic Act and the
regulations promulgated thereunder, including without
limitation, at 21 CFR Parts 210, 211, 600-610 and 820, as
appropriate.
1.4 "Clinical Plan" means that written plan, as may be amended from
time to time, prepared by the JPT and approved by the JSC,
describing the clinical research plan for the Clinical Program,
as described in Section 2.9 and Article 4 below. The Clinical
Plans, approved by the JSC as described herein below, are
incorporated into this Agreement by reference.
1
1.5 "Clinical Program" means the clinical program for Phase I, Phase
II and Phase III Clinical Trials described in Clinical Plans.
1.6 "Clinical Supply" means supplies of Monoclonal Product and/or
SM Product, manufactured, packaged and labeled in compliance
with cGMP, for use in Clinical Trials hereunder and in an amount
adequate for such purposes. To the extent that Genentech is
manufacturing Clinical Supply for use in the Dendreon Territory
pursuant to Section 7.9.2 below, Clinical Supply will also
include, under the terms and conditions hereunder, Monoclonal
Product and/or SM Product for use in clinical trials conducted
by Dendreon or by a Dendreon licensee in the Dendreon Territory.
1.7 "Clinical Trial" means any clinical study of a Licensed Product
in human subjects that is sponsored by, and conducted by or on
behalf of, Dendreon or Genentech hereunder in the Territory. A
Clinical Trial is commenced when the first patient receives the
first dose of the Licensed Product as the investigational
therapeutic drug under the protocol applicable to that clinical
study.
1.8 "Clinical Trial Costs" means the FTE Costs and Third Party Costs
incurred in conducting a Clinical Trial, including, without
limitation, the costs to prepare and file an IND (as applicable
to each Party under the terms of this Agreement), and the fees
paid to Third Party investigators, consultants, and contract
research organizations; provided, however, that the term does
not include the costs of cGMP manufacturing of Licensed Product,
manufacturing scale-up, engineering or other costs to enable
cGMP manufacturing of larger volumes of Licensed Product, or
Regulatory Filings or Regulatory Approvals associated with the
manufacture of Licensed Product incurred through the Completion
of Phase II Clinical Trials for such Licensed Product.
1.9 "Collaboration Invention" means inventions or discoveries
(whether patentable or not) made after the Effective Date during
the course of, in furtherance of, and as a direct result of the
activities of the Parties hereunder and which directly relate to
Trp-p8, or any Licensed Product (including for purposes of this
definition, Small Molecules and SM Products), its manufacture or
its use. A "Collaboration Invention" may be made solely by one
or more employees or consultants of Dendreon (a "Dendreon
Collaboration Invention"), solely by one or more employees or
consultants of Genentech (a "Genentech Collaboration
Invention"), or jointly by employees or consultants of Dendreon
and Genentech ("Joint Collaboration Inventions"), as determined
according to U.S. patent law. For purposes of this definition,
"Licensed Product" shall not include Licensed Trp-p8 Vaccine
Products. Collaboration Inventions shall include inventions or
discoveries (whether patentable or not) that directly relate to
Licensed Trp-p8 Vaccine Products only following execution of an
agreement hereunder between Dendreon and Genentech applicable to
Licensed Trp-p8 Vaccine Products and then only during the course
of, in furtherance of, and as a direct result of activities
under such agreement.
2
1.10 "Collaboration Invention Patent Rights" means Patent Rights to
the extent such Patent Rights claim any Collaboration Invention.
1.11 "Commercial Supply" means the supplies of Licensed Product,
manufactured, packaged and labeled in compliance with cGMP, in
such form and strength as approved for sale by applicable
Regulatory Agencies for commercial sale for use in the Field in
the Territory pursuant to this Agreement. To the extent that
Genentech is manufacturing Commercial Supply for use in the
Dendreon Territory pursuant to Section 7.9.3 below, Commercial
Supply will also include, under the terms and conditions
hereunder, Monoclonal Product and SM Product approved for sale
by applicable Regulatory Agencies in the Dendreon Territory.
1.12 "Commercially Reasonable and Diligent Efforts" means, with
respect to development and commercialization hereunder, a
Party's use of best efforts and resources consistent with the
exercise of prudent scientific and business judgment, as applied
by such Party to other pharmaceutical products of similar
potential, market size and competitive environment.
1.13 "Commercialization Plan" has the meaning set forth in Section
7.4.
1.14 "Completion of Phase II (or Phase III) Clinical Trials" means
the delivery of a final report to the JPT on the outcome of the
Phase II or Phase III Clinical Trial, as the case may be.
1.15 "Confidential Information" means all nonpublic and/or
proprietary information of a Party disclosed to, observed by or
otherwise obtained by the other Party in the course of this
Agreement. It includes information relating to employees,
methods, techniques and processes, technical and scientific
data, biological material, know-how, specifications, patent
applications algorithms, programs, designs, drawings, formulae,
and engineering, manufacturing, marketing, financial and
business plans and data. It may include information other than
that which derives actual or potential economic value from not
being generally known to or accessible by proper means and by
other persons who can gain economic value from it.
1.16 "Controlled" means, with respect to a particular item, material,
or intellectual property right, that a Party owns or has a
license to such item, material or intellectual property right
and the ability to grant to the other Party access to and/or a
license or sublicense under such item, material or intellectual
property right as provided for herein without violating the
terms of any agreement or other arrangement with any Third
Party.
1.17 "Covering" (including variations such as "Covered," "Covers" and
the like) shall mean that the use, manufacture, sale, offer for
sale or importation of Trp-p8 or of a Licensed Product(s) would
infringe a Valid Claim in a patent, or a claim in a patent
application which would be a Valid Claim if such claim issued in
a patent, in the absence of rights under such patent or patent
application, as determined on a country-by-country basis.
1.18 "DENDREON/GNE Development Costs" shall have the meaning defined
in Exhibit B.
3
1.19 "Dendreon Know-how" means Know-how Controlled by Dendreon;
provided, however, that Dendreon Know-how excludes any Know-how
licensed to Dendreon by Genentech under this Agreement and
excludes Dendreon Know-how related to Licensed Trp-p8 Vaccine
Products unless Genentech obtains a license to Licensed Trp-p8
Vaccine Products pursuant to this Agreement. In the event
Genentech obtains such a license, the term Dendreon Know-how
shall also include Know-how related to Licensed Trp-p8 Vaccine
Products.
1.20 "Dendreon Patent Rights" means Patent Rights Controlled by
Dendreon as of the Effective Date and hereafter during the Term
of this Agreement, but excluding (a) Vaccine Product Patent
Rights, (b) Dendreon's interest in Collaboration Invention
Patent Rights and (c) the rights granted under this Agreement to
Dendreon by Genentech under Genentech Patent Rights.
1.21 "Dendreon Territory" means the following countries: Japan,
Australia, New Zealand, the Peoples Republic of China (including
Hong Kong and Macao), Taiwan, South Korea, North Korea,
Mongolia, Vietnam, Laos, Cambodia, Thailand, Myanmar,
Philippines, Brunei, Singapore, Indonesia and Malaysia.
1.22 "Developmental Research" means that portion of the Preclinical
Program for Monoclonal Products and SM Products conducted
hereunder to determine the potential efficacy, safety and
toxicity of promising Small Molecules and Monoclonal Antibodies,
through studies in animal models, and other research by the
Party or Parties to evaluate the suitability of such Small
Molecules and Monoclonal Antibodies for Clinical Trials.
Developmental Research hereunder shall begin at the point in
time when the lead Monoclonal Antibodies and/or Small Molecules
are to be chosen for such evaluation and the JPT is formed
hereunder.
1.23 "Discovery Research" means that research portion of the
Preclinical Program conducted hereunder to discover and evaluate
Monoclonal Antibodies and Small Molecules in order to identify
potential lead Monoclonal Antibodies and Small Molecules that
exhibit sufficient Trp-p8 binding and other characteristics to
warrant further evaluation in Developmental Research.
1.24 "Effective Date" means the date that this Agreement becomes
effective which shall be the date first written above.
1.25 "FDA" means the United States Food and Drug Administration.
1.26 "Field" means any human or animal use.
1.27 "FTE" means a full-time equivalent employee of a Party who
performs work in the Preclinical or Clinical Program for
Licensed Products hereunder.
4
1.28 "FTE Costs" means the cost of an FTE working for one year
(including normal holidays and vacation), which shall be based
upon the cost systems of each Party, as confirmed by the
financial representatives of each of the Parties.
1.29 "Genentech Know-how" means Know-how Controlled by Genentech,
excluding Know-how related to the manufacture of Licensed
Product and any other Manufacturing Know-how, and excluding
Know-how licensed to Genentech by Dendreon under this Agreement.
1.30 "Genentech Patent Rights" means all Patent Rights Controlled by
Genentech as of the Effective Date and hereafter during the Term
of this Agreement, but excluding (a) Genentech's interest in
Collaboration Invention Patent Rights, (b) the Itakura/▇▇▇▇▇
Patents listed on Exhibit C attached hereto and incorporated
herein, and (c) the rights granted under this Agreement to
Genentech by Dendreon under Dendreon Patent Rights.
1.31 "IND" means an effective Notice of Claimed Investigational New
Drug Exemption, as defined in Title 21 of the U.S. Code of
Federal Regulations.
1.32 "Joint Project Team" or "JPT" means the committee established
pursuant to Article 4 below.
1.33 "Joint Steering Committee" or "JSC" means the committee
established pursuant to Article 3 below.
1.34 "Joint Collaboration Invention" shall have the meaning set forth
in Section 1.8 above.
1.35 "Joint Patent Rights" means Patent Rights to the extent such
Patent Rights claim any Joint Collaboration Invention as well as
Patent Rights established pursuant to Section 8.1.2 below.
1.36 "Know-how" means all proprietary information, trade secrets,
techniques and data of a Party, including Confidential
Information, which directly relates to Trp-p8 or Licensed
Products, which is necessary for the activities under this
Agreement and that is Controlled by such Party as of the
Effective Date or hereafter during the Term of this Agreement,
including, but not limited to, formulae, materials, practices,
methods, knowledge, know-how, processes, experience, test data
(including pharmacological, toxicological and clinical
information and test data), analytical and quality control data,
batch records, marketing, pricing, distribution, cost and sales
data or descriptions. "Know-how" may be made prior to the
Effective Date or during and in furtherance of the collaboration
hereunder solely by employees or consultants of Dendreon, solely
by employees or consultants of Genentech, jointly by employees
or consultants of Dendreon and Genentech, or jointly by Dendreon
or Genentech employees or consultants and a Third Party.
1.37 "Licensed Product" means any formulation containing a Monoclonal
Antibody, Small Molecule, or any other molecule that selectively
and/or specifically binds to Trp-p8 or that is a Licensed Trp-p8
Vaccine Product. "Licensed Product" shall exclude Small
Molecules and SM Products unless Genentech exercises its option
in accordance with Section 2.6.2
5
below; in the event Genentech does so exercise such option, the
term "Licensed Product" shall also include Small Molecules and
SM Products. "Licensed Product" shall exclude Licensed Trp-p8
Vaccine Products unless Genentech and Dendreon enter into an
agreement, by way of amendment to this Agreement, for the
development and/or commercialization of Licensed Trp-p8 Vaccine
Products hereunder in accordance with Section 2.7 below; in the
event Genentech and Dendreon enter into such an agreement the
term "Licensed Product" shall also include Licensed Trp-p8
Vaccine Products, subject to the terms of such amendment and to
the extent set forth therein.
1.38 "Licensed Trp-p8 Vaccine Product" means a formulation that is
designed to specifically induce a T-cell response primarily to
Trp-p8.
1.39 "Manufacturing Know-how" means any Know-how concerning the
engineering, manufacturing and quality/or assurance testing of
a Licensed Product.
1.40 "Monoclonal Antibody" means a monoclonal antibody that
specifically and selectively binds Trp-p8, including, without
limitation, such monoclonal antibodies that are humanized
antibodies.
1.41 "Monoclonal Product" means a Licensed Product that is a
formulation containing a Monoclonal Antibody.
1.42 "NDA" means a New Drug Application made to obtain approval from
the FDA for commercial sale of a Licensed Product or any
comparable filing with any relevant Regulatory Agency in any
country in the Territory other than the United States
1.43 "Net Sales" in United States shall have the meaning defined in
Exhibit B. "Net Sales" for countries in the Territory outside
the United States and in the Dendreon Territory shall mean
Gross Sales of a Licensed Product less applicable Sales Returns
and Allowances where:
(a) "Gross Sales" means, for purposes of the calculation of
royalties by the Party paying royalties, the gross amount
invoiced for sales of a Licensed Product by such Party or
its sublicensee to Third Parties in the Territory outside
the United States or in the Dendreon Territory as the
case may be;
(b) "Sales Returns and Allowances" means, for purposes of the
calculation of royalties by the Party paying royalties,
the sum of (i) and (ii), where: (i) is a provision,
determined by such Party or its sublicensee in accordance
with commonly accepted accounting principles in the
country in which the sale occurred for sales of Licensed
Products for (1) trade, cash and quantity discounts or
rebates on Licensed Products (other than price discounts
granted at the time of invoicing and which are included
in the determination of Gross Sales), (2) credits or
allowances given or made for rejection or return of, and
for uncollectable amounts on, previously sold Licensed
Products or for retroactive price reductions (including
Medicare and other government rebates and chargebacks),
(3) taxes (excluding local, state or national taxes on
the income of such Party or its sublicensee), duties or
other governmental charges levied on or measured by the
billing amount for Licensed Products, as
6
adjusted for rebates and refunds, (4) charges for
freight and insurance directly related to the
distribution of Licensed Products, to the extent
included in Gross Sales, (5) credits for allowances
given or made for wastage replacement, and (6) other
special sales programs agreed to by the Parties for
Licensed Products; and (ii) is a periodic adjustment of
the provision determined in (i) to reflect amounts
actually incurred by such Party for items (1), (2),
(3), (4), (5), and (6) in clause (i).
1.44 "New Molecule" means a Monoclonal Antibody or Small Molecule
for which the JSC approves development hereunder for a Licensed
Product and that (i) with respect to a Monoclonal Antibody has
a different amino acid sequence from the Monoclonal Antibody
contained in the formulation of the Monoclonal Product already
being developed by the Parties in the collaboration hereunder
or that has received Regulatory Approval in the United States
and (ii) with respect to a Small Molecule is of a different
chemical composition than the Small Molecule contained in the
formulation of the SM Product already being developed by the
Parties in the collaboration hereunder or that has received
Regulatory Approval in the United States.
1.45 "Operating Profits and Losses" shall have the meaning defined
in Exhibit B.
1.46 "Party" or "Parties" mean Dendreon or Genentech or both of
them, respectively.
1.47 "Patent Rights" means all U.S. and foreign patents and patent
applications and any patents issuing therefrom, and any
reissues, extensions, registrations, continuations, divisions,
continuations-in-part, reexaminations, substitutions or
renewals thereof, and supplementary protection certificates
based thereon to the extent the above contain one or more
claims Covering Trp-p8 or any Licensed Product.
1.48 "Permitted Assignee" means any entity to which assignment is
permitted in accordance with Section 12.3.
1.49 "Phase I Clinical Trial" means, for any Licensed Product, a
study in the Territory that constitutes a clinical evaluation
of the safety of the Licensed Product in human subjects to
provide information about the medical risks and
pharmacokinetics associated with the use of such Licensed
Product, and a preliminary indication of its potential
efficacy.
1.50 "Phase II Clinical Trial" means, for any Licensed Product, a
study in the Territory conducted under this Agreement that
constitutes a controlled clinical evaluation of the
effectiveness of the Licensed Product in human patients with
the disease under study to provide information about
dose-response, pharmacokinetics/pharmacodynamics, dose regimen,
safety and efficacy of the Licensed Product, and which is
conducted after a Phase I Clinical Trial of such Licensed
Product.
1.51 "Phase III Clinical Trial" means, for a Licensed Product, a
study in the Territory conducted under this Agreement to
confirm the safety and efficacy of such Licensed Product in the
treatment of patients with the disease under study. A Phase III
Clinical Trial is undertaken with the intent that, should
sufficient positive study data result, a BLA or NDA will be
submitted to a Regulatory Agency.
7
1.52 "Pivotal Trial" is a Phase II Clinical Trial that produces
positive study data that the FDA determines in a pre-BLA
meeting is sufficient to warrant submission of a BLA or NDA
without data from a Phase III Clinical Trial.
1.53 "Preclinical Plan" means that written plan for the Preclinical
Program, as may be amended from time to time, prepared by one
or both of the Parties.
1.54 "Preclinical Program" means that program of Discovery Research
and Developmental Research for Small Molecules and Monoclonal
Antibodies conducted hereunder prior to filing an IND for such
Small Molecules and Monoclonal Antibodies in order to conduct
the first Clinical Trial for such Licensed Product. The
Preclinical Program is generally described in Sections 2.3 and
2.5 and more specifically described in the Preclinical Plan for
such Licensed Product.
1.55 "Preclinical Program Costs" means all FTE Costs and Third Party
Costs incurred for a Preclinical Program.
1.56 "Prevalent Cancer" means primary neoplastic disease of one of
the following human organs, at any stage of such disease:
prostate, breast, lung, ovarian, colon, and skin (i.e.
melanoma).
1.57 "Product Development Program" means the efforts of the Parties
hereunder to generate commercially viable Licensed Products, as
described in Article 2.
1.58 "Regulatory Agency" means any federal, state or local agency,
department, bureau or other governmental entity, within a
regulatory jurisdiction in the Territory, with the authority to
grant any approvals, licenses, registrations or authorizations
necessary for the clinical development, manufacture or sale of
a Licensed Product under this Agreement.
1.59 "Regulatory Approval" means any approval (including price and
reimbursement approvals), licenses, registrations or
authorizations by any Regulatory Agency necessary for the
clinical development, manufacture, use, storage, import,
transport, marketing, distribution or sale of a Licensed
Product in a regulatory jurisdiction.
1.60 "Regulatory Filings" means a filing with a Regulatory Agency
that relates to a Regulatory Approval.
1.61 "Research Grade Material" means Licensed Product that is not
manufactured in accordance with cGMP and is suitable for use
only in vitro or in animals.
1.62 "SM Product" means a Licensed Product that is a formulation
containing a Small Molecule.
8
1.63 "Small Molecule" means a molecule that selectively binds to
Trp-p8 and that has a molecular weight under approximately 1000
daltons.
1.64 "Term" shall have the meaning specified in Section 10.1.
1.65 "Territory" means worldwide except the Dendreon Territory.
1.66 "Third Party" means any person other than a Party to this
Agreement.
1.67 "Third Party Costs" means expenses, other than FTE Costs,
incurred by a Party as payments to Third Parties in connection
with conducting the applicable portion of a Preclinical or
Clinical Program.
1.68 "Trp-p8" means the gene sequence described in Exhibit A
attached hereto and incorporated herein, any portions thereof,
and any allelic variant thereof, and any proteins encoded by
this sequence or such variant.
1.69 "Tumor Type" means a primary neoplastic disease of a singular
histology, including any metastasis thereof, as accepted in
standard medical practice.
1.70 "Vaccine Product Patent Rights" means Patent Rights Controlled
by Dendreon that relate to a Licensed Trp-p8 Vaccine Product,
excluding Dendreon Patent Rights and excluding Dendreon's
interest in Collaboration Invention Patent Rights.
1.71 "Valid Claim" means an unexpired claim in an issued unexpired
patent within the Patent Rights that has not been revoked,
abandoned, disclaimed or withdrawn, or held unenforceable,
unpatentable or invalid by a court of competent jurisdiction in
a final judgment that has not been appealed within the time
allowed by law or from which there is no further appeal.
2. Scope of the Product Development Program
2.1 Product Development Program.
(a) Dendreon and Genentech hereby establish, pursuant and
subject to the terms of this Agreement, a Product
Development Program to develop Licensed Products, with
the primary goal of obtaining Regulatory Approval in the
United States of Licensed Products in Prevalent Cancers
and commercially significant other indications. The
Parties efforts in this Product Development Program will
initially be the development of Monoclonal Products and
Small Molecule Products. Each Party shall use
Commercially Reasonable and Diligent Efforts to perform
its respective tasks and obligations in conducting all
development work ascribed to it in the Preclinical Plans
and Clinical Plans for Monoclonal Products and SM
Products hereunder.
9
(b) The Product Development Program shall consist of two
principal phases: the Preclinical Program and the
Clinical Program. The Preclinical and Clinical Programs
are generally described in this Article 2 below and shall
be more fully detailed in written Preclinical Plans and
Clinical Plans. The Product Development Program shall be
approved and guided by the Joint Steering Committee, as
described in Article 3. The costs of the Product
Development Program shall be borne by the Parties as
described in this Article 2.
2.2 Preclinical Program. The Preclinical Program for Monoclonal
Products and SM Products will consist of Discovery Research
followed by Developmental Research, and will commence on a
start date that is not later than sixty (60) days following the
Effective Date. By such start date, Genentech will develop an
initial written Preclinical Plan for a Monoclonal Product to
guide its efforts in such Preclinical Program that shall be
incorporated by reference into this Agreement. By such start
date, Dendreon will develop an initial written Preclinical Plan
for an SM Product to guide its efforts in such Preclinical
Program that shall be incorporated by reference into this
Agreement. The Preclinical Plans for Monoclonal Products and SM
Products shall include a description of any proposed material
Third Party contractual relationships for goods or services to
carry out the plan. The Preclinical Plan for SM Products shall
be submitted to the JSC for review and comment; provided,
however, that following Genentech's exercise of its option as
provided in Section 2.6, any revisions to the Preclinical Plan
for SM Products, including budgets, shall be submitted to the
JSC for review, comment, and JSC approval of milestones,
timelines and deliverables. The Preclinical Plan for Monoclonal
Products shall be submitted to the JSC for review, comment, and
JSC approval of milestones, timelines, and deliverables. The
comments of the other Party and of the JSC shall be taken into
consideration by the Party authoring the Plan. Neither Party
shall materially modify or amend its Preclinical Plan without
first submitting the Plan to the JSC for review and approval or
comment as provided above. The Parties intend that their
respective research employees shall regularly discuss and share
information about ongoing activities under their respective
Preclinical Plans.
2.3 Monoclonal Product.
2.3.1 Genentech Responsibilities. Genentech will be primarily
responsible for the Preclinical Program for Monoclonal Products
and the identification of potential lead Monoclonal Antibodies.
Genentech's Preclinical Plan for Monoclonal Product shall
address, without limitation, the following elements:
(a) An initial phase research program that will (i) generate
[...***...] for [...***...], (ii) develop [...***...] to
[...***...] and [...***...], (iii) develop [...***...],
(iv) evaluate the [...***...] and [...***...] of
[...***...], (v) generate [...***...], (vi) identify an
[...***...] to the [...***...] that [...***...], (vii)
evaluate [...***...] in [...***...], and (viii) develop
a [...***...].
(b) Estimated milestones, timelines, and deliverables for
each key component of the program.
(c) Assignment of specific tasks to Dendreon, if applicable,
as agreed by the Parties.
(d) An estimate of each Party's FTE resources that will be
devoted to the Preclinical Program each calendar year.
*** Confidential Treatment Requested
10
Genentech shall provide all necessary Research Grade Material,
at its sole expense, for the Preclinical Program for
Monoclonal Product as further described in Section 7.9.2
below. Dendreon will promptly transfer to Genentech all of its
available reagents to develop and evaluate Monoclonal
Antibodies to Trp-p8. Dendreon may conduct activities for such
Preclinical Program at Genentech's request as agreed by the
Parties through the JSC (or through the JPT during
Developmental Research). Genentech and Dendreon shall each
exercise Commercially Reasonable and Diligent Efforts to
complete such tasks and activities in accordance with accepted
professional standards and the Preclinical Plan for Monoclonal
Product, and shall provide information and reports on the
results of their efforts, as requested by the JSC or JPT for
discussion at their respective meetings. Each Party shall
maintain scientific staff, laboratories, and other facilities
necessary to carry out its tasks under such Preclinical Plan.
2.3.2 Dendreon Independent Activities. With the approval of
the JSC, Dendreon may also pursue its own Preclinical Program
activities hereunder for the discovery of a lead Monoclonal
Antibody candidate(s), without Genentech's request for such
activities, at its sole cost. In that event, Dendreon shall
provide the JSC with an annual report of the Preclinical
Program Costs to date and an estimated budget for such costs
anticipated to be incurred in the succeeding year. In
addition, Dendreon will provide information on the status of
its efforts as reasonably requested by the JSC or JPT for
discussion at their respective meetings.
2.4 Decision Point - Monoclonal Product. Within ninety (90) days
after the conclusion of the Preclinical Program for Monoclonal
Products, as defined in the applicable Preclinical Plan and
confirmed by the JPT and approved by the JSC, the JPT will
identify a lead Monoclonal Antibody(ies) and determine (as
approved by the JSC) whether, given the results of such
Preclinical Program and the objective of the Product
Development Program, to proceed to Clinical Trials for such
lead Monoclonal Antibody(ies). If the JSC approves the
decision to proceed to such Clinical Trials, Dendreon will
prepare and file an IND pursuant to Section 2.18.1 below, and
the Parties will proceed to the Clinical Program for one or
more Monoclonal Products. A decision not to proceed to such
Clinical Trials shall not affect the obligation of Genentech
to reimburse Dendreon for Preclinical Program Costs incurred
in accordance with Section 2.8.1 below.
2.5 SM Product.
2.5.1 Dendreon Responsibilities. Dendreon shall be primarily
responsible for the Preclinical Program for SM Products and
the identification of a lead Small Molecule. The Preclinical
Plan for SM Products, which shall be prepared by Dendreon with
input by Genentech, shall address, without limitation, the
following elements:
(a) A research program that will include (i) assay
development, (ii) lead Small Molecule identification;
(iii) optimization of identified leads; (iv) efficacy
studies; (v) toxicology studies; (vi)
pharmacokinetics and pharmacodynamics studies; and
(vii) manufacturing.
11
(b) Estimated milestones, timelines, and deliverables for each key
component of the program.
(c) Assignment of specific tasks to Genentech, if applicable, as
agreed by the Parties.
(d) An estimate of each Party's FTE resources that will be devoted to
the Preclinical Program each calendar year.
Dendreon shall provide all necessary Research Grade Material, at its
sole expense, for the Preclinical Program for SM Product as further
described in Section 7.9.1below. Genentech may conduct activities for
such Preclinical Program at Dendreon's request as agreed by the Parties
through the JSC (or through the JPT during Developmental Research).
Dendreon and Genentech shall each use Commercially Reasonable and
Diligent Efforts to complete its respective tasks in accordance with
accepted professional standards and the Preclinical Plan for SM Product
and provide information and reports about the results of their efforts
as requested by the JSC or JPT for discussion at their respective
meetings. Each Party shall maintain scientific staff, laboratories, and
other facilities necessary to carry out its tasks under such
Preclinical Plan.
2.5.2 Genentech Independent Activities. Genentech may pursue its own
Preclinical Program activities for the discovery of a lead Small
Molecule candidate(s) without Dendreon's request for such activities,
at its sole cost. In that event, Genentech shall obtain the approval of
the JSC for such activities and provide the JSC with an annual report
of all Preclinical Program costs to date of the report and an estimated
budget for such costs anticipated to be incurred in the succeeding
year. In addition, Genentech will provide information on the status of
its efforts as reasonably requested by the JSC or JPT for discussion at
their respective meetings.
2.5.3 Decision Point - SM Products. If Genentech has exercised its
option for SM Products in accordance with Section 2.6, then within
ninety (90) days after the conclusion of the Preclinical Program for SM
Products as defined in the applicable Preclinical Plan and confirmed by
the JPT and approved by the JSC, the JPT will identify a lead Small
Molecule(s) and determine (as approved by the JSC) whether, given the
results of the Preclinical Program and the objective of the Product
Development Program, to proceed to Clinical Trials for such lead Small
Molecule(s). If, as of the completion of the Preclinical Plan for SM
Products, Genentech has not yet exercised such option, Genentech will
first be given the opportunity to exercise its option in Section 2.6.2.
Following such exercise, the JPT and JSC will make the determinations
described above. If Genentech does not exercise such option, Dendreon
shall be free to proceed independently as provided in Section 2.6.1.
2.5.4 Small Molecule Agreements. The Parties anticipate that Dendreon
will use Third Parties to conduct Small Molecule screening and other
Small Molecule Discovery Research or Developmental Research activities
and that it may be necessary or desirable to compensate such Third
Parties by way of royalties. Before Genentech elects to exercise the
option provided in Section 2.6, Dendreon will obtain the advance
consent of the Genentech members of the JSC to any proposed agreement
that entails the payment of royalties to a Third Party based upon sales
of SM Product or imposes any other
12
commitment or obligation on the collaboration hereunder or
that impairs the express rights of the Parties under this
Agreement. Following Genentech's exercise of such option, the
advance consent of the JSC shall also be required for any such
agreement. The foregoing consents shall not be unreasonably
delayed or denied. The advance consent of Genentech, which
shall not be unreasonably delayed and may be denied in its
sole discretion, shall be required at any time for any
agreement involving a license by Dendreon of Patent Rights to
such Third Party related to SM Product; provided, however,
that if Genentech does not exercise such option as provided in
Section 2.6, then Dendreon shall be free to proceed with such
Third Party licenses and royalty agreements without notice to
or the consent of the JSC or Genentech.
2.6 Genentech Option for SM Products.
2.6.1 Exclusive Option. Genentech shall have an exclusive
option to participate in the clinical development and
commercialization of SM Products. Genentech may exercise this
option as provided in Sections 2.6.2 and 2.6.3 below. Unless
and until Genentech exercises its option as provided therein
and pays the option exercise fee set forth in Section 6.4.2
below, Genentech shall have no license, title or property
interest in Dendreon Patent Rights or Dendreon's interests in
Collaboration Inventions with respect to any SM Product except
as set forth in Section 5.1(b) and 8.1.2 below. If Genentech
does not exercise its option pursuant to Section 2.6.2 or
2.6.3, Dendreon shall be free to proceed, alone or with a
Third Party, to develop and commercialize Small Molecules and
SM Products, and Genentech shall have no obligation to make
the milestone payments for SM Product set forth in Section 6.4
below. In addition, (i) the license to Genentech in Section
5.1(b) and (c) shall be deemed terminated, and (ii) Genentech
shall take the actions required by Section 8.4.3.
2.6.2 Exercise of Option. Upon completion of the Small
Molecule Preclinical Plan, as defined in such Preclinical Plan
and as confirmed by the JPT and approved by the JSC, for lead
Small Molecule(s) for SM Product(s), Dendreon will provide
Genentech with: (1) data on such lead Small Molecule(s),
including oral bioavailability data in two species, potency,
selectivity, absorption, transport, specificity, efficacy
(including any in vivo efficacy), metabolism, toxicology,
manufacturing (if any), and pharmacokinetic data including
oral bioavailability that relate to proceeding with Clinical
Trials of such lead Small Molecules for development as a SM
Product, and (2) reagents to validate such Small Molecule
leads in Genentech models. Genentech may request additional
information, including reasonable data on other Small
Molecules and derivatives thereof generated by Dendreon during
its research efforts to identify a lead Small Molecule, which
Dendreon will make reasonable efforts to supply. Genentech
shall have sixty (60) days from receipt of all of the Small
Molecule information required under the first sentence of this
subsection to exercise its option to collaborate with Dendreon
in a Clinical Program for this and all other SM Products and
any resulting commercialization hereunder of such products.
Genentech shall exercise its option by delivery of written
notice to Dendreon within such sixty (60) day period and
payment of the required option exercise fee pursuant to
Section 6.4.2. A decision by Genentech not to exercise this
option shall not alter Dendreon's obligation to reimburse
Genentech for Preclinical Program costs pursuant to Section
2.8.2 .
13
2.6.3 Early Exercise. In addition to the option exercise
provisions in Section 2.6.2 above, Genentech shall also have
the right to exercise its option to SM Products at any time
prior to such Preclinical Plan completion by giving Dendreon
written notice of such exercise and paying the required option
exercise fee pursuant to Section 6.4.2.
2.7 Licensed Trp-p8 Vaccine Products.
2.7.1 Vaccine Products. The Parties acknowledge that prior to
the Effective Date, Dendreon has independently conducted, and
may continue to conduct, certain research and development work
for Licensed Trp-p8 Vaccine Products, at its sole cost.
Dendreon will conduct such activities independently and
without the oversight or input of the JSC or JPT.
2.7.2 Genentech First Right of Negotiation.
(a) Genentech shall have the exclusive first right to
negotiate an agreement with Dendreon to participate in
the development and/or commercialization of Licensed
Trp-p8 Vaccine Products in the Territory as provided in
this Section. When Dendreon first decides to enter into
a development and/or commercialization agreement for
Licensed Trp-p8 Vaccine Products, Genentech shall have
the exclusive first right to negotiate an agreement
with Dendreon to participate in the development and
commercialization of Licensed Trp-p8 Vaccine Products,
as follows. Dendreon shall provide Genentech with: (1)
written notice of its intent to seek a development
and/or commercialization agreement for Licensed Trp-p8
Vaccine Products with a Third Party and (2) summary
data and information regarding toxicity, generation of
immune response against the vaccine target, clinical
efficacy data, and any manufacturing issues for the
Licensed Trp-p8 Vaccine Product. Such data and
information shall be deemed to be Confidential
Information and subject to the provisions of Section
11.1 of this Agreement. Dendreon will use reasonable
efforts to provide additional information reasonably
requested by Genentech. Genentech shall have sixty (60)
days from the receipt of written notice from Dendreon
and the data and information described in (2) above
within which to negotiate a mutually agreeable, fully
executed term sheet for the purpose of amending this
Agreement to include Licensed Trp-p8 Vaccine Products.
If the parties do not execute such a term sheet within
the sixty (60) day period then, by the end of such
period, Genentech may provide Dendreon with a term
sheet expressly designated as its last, best and final
offer ("Last Term Sheet Offer"). Upon expiration of the
sixty (60) day period without agreement upon the term
sheet by the Parties, Dendreon shall be free to
negotiate with any Third Party for the development
and/or commercialization of Licensed Trp-p8 Vaccine
Products; provided that an agreement reached with a
Third Party with respect to Licensed Trp-p8 Vaccine
Products may not be on terms that, considered as a
whole, are materially less favorable to Dendreon than
the Last Term Sheet Offer.
(b) If the Parties execute such term sheet with respect to
Licensed Trp-p8 Vaccine Products, Genentech will pay
Dendreon a reservation fee of [...***...] within five
(5) working days of such execution and the Parties
shall thereafter have one
***Confidential Treatment Requested
14
hundred eighty (180) days to negotiate and execute a
final and binding amendment to this Agreement based
upon such term sheet. If the Parties execute such an
amendment within that period, the reservation fee shall
be applied to the earliest license fees payable with
respect to Licensed Trp-p8 Vaccine Products under such
amendment. If the Parties are unable to reach an
agreement within such 180 day period, Dendreon shall
refund the reservation fee to Genentech (without
interest) and shall thereafter be free to negotiate
with any Third Party for the development and/or
commercialization of Licensed Trp-p8 Vaccine Products;
provided that an agreement with a Third Party with
respect to Licensed Trp-p8 Vaccine Products may not be
on terms that, considered as a whole, are materially
less favorable to Dendreon than the terms last offered
by Genentech's to Dendreon during such 180 day
negotiation period.
(c) Notwithstanding the use of the term "Licensed Products"
in this Agreement, the Parties expect that the
amendment contemplated above may make substantially
different provisions for license fees, milestones,
sharing of profits and losses, royalties, and the
Parties' respective roles and responsibilities with
respect to development and/or commercialization of such
Licensed Trp-p8 Vaccine Products. The Parties further
expect that the terms of this Agreement with respect to
Patent Rights and Know-How and the terms of Articles
3,4, 5, 8, 9, 10, 11, and 12 will remain substantially
unchanged by such amendment. In all cases, the terms of
the amendment as agreed by the Parties shall control
with respect to Licensed Trp-p8 Vaccine Products.
2.8 Preclinical Program Costs.
2.8.1 Genentech Costs. Genentech shall bear all of the
Preclinical Program Costs for Monoclonal Antibodies and
Monoclonal Products. If Genentech requests that Dendreon complete
tasks under the Monoclonal Product Preclinical Plan and Dendreon
agrees to complete such tasks, then Genentech shall promptly
reimburse Dendreon for its Preclinical Program Costs in
completing such Preclinical Plan tasks that do not exceed the
amount specified in the budget agreed upon by the Parties for
those activities by more than [...***...]. Notwithstanding the
above, Dendreon will bear the costs of any Preclinical Program
activities for Monoclonal Antibodies that it conducts not
specifically requested by Genentech. Genentech also shall bear
all Preclinical Program costs, if any, for Additional Products
and New Molecules, except to the extent Dendreon has elected to
share DENDREON/GNE Development Costs pursuant to Section 2.14.
2.8.2 Dendreon Costs. Dendreon shall bear all of the
Preclinical Program Costs for Small Molecules and SM Products. If
Dendreon requests that Genentech complete tasks under the SM
Product Preclinical Plan and Genentech agrees to complete such
tasks, then Dendreon shall promptly reimburse Genentech for its
Preclinical Program Costs in completing such Preclinical Plan
tasks that do not exceed the amount specified in the budget
agreed upon by the Parties for those activities by more than
[...***...]. Notwithstanding the above, Genentech will bear the
costs of any Preclinical Program activities for Small Molecules
that it conducts not specifically requested by Dendreon.
***Confidential Treatment Requested
15
2.8.3 Payment for Independent Activities.
(a) Notwithstanding Section 2.8.1 above, in the event that Dendreon,
instead of Genentech, discovers or otherwise brings a Monoclonal
Antibody to the JSC (or JPT if the JPT is established at that
time) which is then approved by the JSC to be the lead Monoclonal
Antibody for the first Monoclonal Product and for evaluation in
Clinical Trials, then Genentech shall reimburse Dendreon, within
sixty (60) days after the JSC's approval to proceed to Clinical
Trials for such Monoclonal Antibody, for all of Dendreon's
Preclinical Program Costs incurred directly related to such lead
Monoclonal Antibody.
(b) Notwithstanding Section 2.8.2 above, in the event that Genentech,
instead of Dendreon, discovers or otherwise brings a Small
Molecule to the JSC (or JPT if the JPT is established at that
time) which is then approved by the JSC to be the lead Small
Molecule for the first SM Product and for evaluation in Clinical
Trials, then Dendreon shall reimburse Genentech, within sixty
(60) days after the JSC's approval to proceed to Clinical Trials
for such Small Molecule, for all of Genentech's Preclinical
Program Costs incurred directly related to such lead SM Molecule.
2.9 Clinical Program. The JPT will develop, for the JSC's approval, a
written Clinical Plan for Phase I and II Clinical Trials for
Monoclonal Product within ninety (90) days after approval by the JSC
to conduct a Clinical Program with respect to a lead Monoclonal
Antibody(ies). If Genentech has exercised its option, the JPT will
develop for the JSC's approval a written Clinical Plan for Phase I and
II Clinical Trials for SM Product within ninety (90) days after the
JSC's approval to conduct a Clinical Program for a lead Small
Molecule. Upon approval by the JSC of such Clinical Plans for
Monoclonal Product and SM Product, as evidenced by written, approved
JSC minutes, such Clinical Plans shall be incorporated herein by
reference. The Clinical Plans, which may be amended by the JPT, with
approval of the JSC, from time to time, shall include, without
limitation, the following components:
(a) The Monoclonal Product and Small Molecule Product, and
indications, for which Clinical Trials will be conducted. The
Parties anticipate that the first three indications selected
shall be for Prevalent Cancers.
(b) Summaries of the protocols anticipated for each Clinical Trial
along with the timeframe for patient enrollment, forecasts of the
Clinical Supply required for such Clinical Trials, and the
anticipated retention of consultants and contract research
organizations to support the Clinical Trials.
(c) Milestones, timeframes and deliverables for each key component of
the Clinical Program for each Monoclonal Product and Small
Molecule Product.
(d) A budget for Phase I and Phase II Clinical Trials.
(e) Assignment of specific tasks to each Party.
All Clinical Plans shall be drafted so as to conform to the regulatory
requirements of applicable Regulatory Agencies.
16
2.10 Phase I and Phase II Responsibilities.
(a) Dendreon shall be solely responsible for sponsoring Phase I and
Phase II Clinical Trials and for all tasks associated with
conducting each Phase I and Phase II Clinical Trial at its sole
expense, except for manufacturing and supply of Clinical Supplies
of Licensed Product, for the first Monoclonal Product and SM
Product until the first of the following occurs with respect to
each: (i) as there is a Pivotal Trial; (ii) the JSC determines to
proceed which Phase III Clinical Trials; or (iii) the JSC decides
to terminate development efforts for such Licensed Product.
Dendreon's responsibilities under this Section 2.10(a) shall
include the preparation and filing of any required Regulatory
Filings including, without limitation, INDs to conduct such
Clinical Trials.
(b) Genentech shall provide Clinical Supply of Licensed Product for
all Phase I and Phase II Clinical Trials, at its sole expense,
pursuant to a Clinical Supply Agreement to be entered into by the
Parties and shall prepare and file, at its sole expense, any
necessary Regulatory Filing for the manufacture of such Clinical
Supply in the Territory. In addition, Genentech shall be
responsible for all tasks associated with Phase I and Phase II
Clinical Trials for Additional Products and New Molecules at its
sole expense, except to the extent that Dendreon has elected to
share DENDROEN/GNE Development Costs pursuant to Section 2.14.
Genentech's responsibilities under this Section 2.10(b) shall
include the preparation and filing of any required Regulatory
Filings to conduct such Clinical Trials.
(c) Each Party shall exercise Commercially Reasonable and Diligent
Best Efforts to complete its work responsibilities in accordance
with accepted professional standards, applicable laws and
regulations, and the applicable Clinical Plan. Each Party shall
maintain scientific staff, laboratories, offices and other
facilities necessary to carry out its assigned tasks under the
applicable Clinical Plan.
2.11 Phase II Decision Point.
(a) If Phase II Clinical Trials for Monoclonal Product or SM Product
are not Pivotal Trials, then the JSC will determine whether to
approve proceeding with Phase III Clinical Trials based upon an
assessment of whether the results of the Phase II Clinical Trials
warrant proceeding with Phase III Clinical Trials. Within thirty
(30) days after notice from the FDA during any pre-BLA meeting
following Phase II Clinical Trials for a Monoclonal Product or SM
Product that the FDA will accept a BLA or NDA filing based upon
such Phase II Clinical Trial data (i.e. that such Phase II
Clinical Trial is a Pivotal Trial), Genentech will initiate the
preparation of a BLA or NDA for filing with the FDA and the
commercialization efforts for such Monoclonal Product and SM
Product in accordance with Article 7 below. The decisions of the
JSC under this Section shall be binding on the Parties.
(b) If, with respect to each of the first Monoclonal Product or first
SM Product for which Phase I and II Clinical Trials are conducted
hereunder, the JSC agrees not to proceed with Phase III Clinical
Trials for such first Monoclonal Product or first SM Product,
then the JSC will determine in good faith whether to proceed with
17
development of such Monoclonal Product or SM Product, as the case
may be. The decision of the JSC will be binding upon the Parties.
If the JSC cannot agree whether or not to proceed with Phase III
Clinical Trials, but Genentech wishes to proceed to Phase III
Clinical Trials, then Genentech may proceed with Phase III
Clinical Trials upon written notice to Dendreon. Dendreon shall
then have the right within thirty (30) days after receipt of such
notice to make the election provided in Section 2.14 to share
DENDREON/GNE Development Costs and Operating Profits and Losses
with respect to such Licensed Product. If Dendreon does not elect
to share in DENDREON/GNE Development Costs and Operating Profits
and Losses for such Licensed Product, Genentech shall be free to
independently conduct Phase III Clinical Trials, and all other
development and commercialization, for such Licensed Product and
Dendreon shall receive the royalty provided in Section 6.5. If
the JSC cannot agree whether or not to proceed with Phase III
Clinical Trials, and Dendreon wishes proceed to Phase III
Clinical Trials, the issue shall be referred to the Chief
Executive Officers of Dendreon and Genentech for resolution in
accordance with Section 12.9.1.
2.12 Phase I and II Clinical Trial Costs.
(a) Dendreon shall be responsible for all Clinical Trial Costs for
all Phase I and Phase II Clinical Trials as provided in Section
2.10(a). For each SM Product or Monoclonal Product, if Phase II
Clinical Trials are Pivotal Trials , or if the JSC decides to
proceed with Phase III Clinical Trials, then within thirty (30)
days after such decision Genentech shall reimburse Dendreon for
all Phase I and Phase II Clinical Trial Costs incurred by
Dendreon for such Licensed Product. If, however, the completion
date of any Phase I or Phase II Clinical Trial for such Licensed
Product is delayed by more than three (3) months beyond the
completion date stated in the applicable Clinical Plan for such
Clinical Trial, or the Clinical Trial Costs for any Phase I or
Phase II Clinical Trial are more than [...***...] over the dollar
budget amount in the Clinical Plan for such Clinical Trial, for
any reason other than: (i) unexpected regulatory action by the
FDA with respect to such Clinical Trial(s) that is not the fault
of Dendreon, (ii) unexpected safety issues that require a
material change to the protocol(s) of such Clinical Trial(s),
(iii) unexpected adverse safety information about a similar small
molecule or monoclonal antibody product that binds to or
manipulates a transmembrane channel and that significantly
impacts the rate of patient accrual for such Clinical Trial(s),
(iv) manufacturing problems that significantly delay the supply
of such Licensed Product for such Clinical Trial(s) or (v)force
majeure under Section 12.5 below, then Genentech shall reimburse
Dendreon for only [...***...] of the Clinical Trial Costs for
such Phase I and/or Phase II Trials. For purposes of this Section
2.12(a), the completion date of a Phase I or Phase II Clinical
Trial is the date that the last patient is enrolled in the study.
(b) Genentech shall be responsible and shall pay the Clinical Trial
Costs for the Phase I and Phase II Clinical Trials for which it
is responsible pursuant to Section 2.10(b); provided, however,
that Dendreon may elect to share such costs in accordance with
Section 2.14.
***Confidential Treatment Requested
18
2.13 Phase III Clinical Trials. If Dendreon has elected to share
DENDREON/GNE Development Costs and Operating Profits and Losses in
accordance with Section 2.14, then within sixty (60) days of the
approval of the JSC to proceed with Phase III Clinical Trials for a
Licensed Product, the JPT shall amend the Clinical Plan, for JSC
approval, as necessary for the Phase III Clinical Trials for such
Licensed Product. If Dendreon has not made the foregoing election,
then Phase III Clinical Trials shall be conducted by Genentech without
any oversight or control by the JSC or JPT. The amended Clinical Plan
shall address, without limitation, the following:
(a) Plans for the Clinical Trials that include a summary of the
anticipated protocol, a timeframe for patient accruals, the
identification of some of the prospective investigators, the
projected quantity of Clinical Supply required of such Licensed
Product, and the retention of initial consultants and contract
research organizations to support the Clinical Trials.
(b) Clinical Trial endpoints, milestones and deliverables for each
key component of the trials.
(c) Objective Protocol primary endpoints to determine whether the
results of the Phase III Clinical Trials are sufficient to obtain
Regulatory Approval by the FDA to sell such Licensed Product.
Genentech shall be solely responsible at its sole expense for
manufacturing the Clinical Supply of each Licensed Product for the
Phase III Clinical Trial(s) for that Licensed Product, pursuant to the
Clinical Supply Agreement, for all associated Regulatory Filings
necessary to manufacture such Clinical Supply in the Territory, and
for all expense associated with conducting the Phase III Clinical
Trials, including all related Regulatory Filings, as appropriate.
Notwithstanding the foregoing, if Dendreon has elected to share in the
costs for a Licensed Product as provided in Section 2.14 below, then
Dendreon shall share in the expense for all such Clinical Trial
activities and Clinical Supply, as provided in Exhibit B and Section
2.14 below. Genentech shall exercise Commercially Reasonable and
Diligent Efforts to complete its responsibilities in accordance with
accepted professional standards and the amended Clinical Plan, and
shall maintain scientific staff, laboratories, offices and other
facilities necessary to carry out its assigned tasks under the
applicable Clinical Plan.
2.14 SM Product and Monoclonal Product Cost Sharing.
(a) The Parties acknowledge that in consideration for Dendreon
conducting Phase I and Phase II Clinical Trials as provided in
Section 2.10(a), that Dendreon shall have the right to elect to
share in Operating Profit and Loss as provided herein. For the
first SM Product and Monoclonal Product for which Phase II
Clinical Trials are Pivotal Trials or as to which the JSC
approves proceeding with Phase III Clinical Trials, Dendreon may
elect, by giving Genentech written notice within thirty (30) days
after notice from the FDA in the pre-BLA meeting that the FDA
will accept a BLA filing based upon data from a Pivotal Trial or
JSC approval to proceed with Phase III Clinical Trials, to share
with Genentech all DENDREON/GNE
19
Development Costs for the Phase III Clinical Trials and Clinical
Trials thereafter, manufacturing costs, other costs, revenues,
and the resulting Operating Profits and Losses in the United
States, for such Licensed Product thereafter, with [...***...]
Genentech in accordance with the Financial Planning, Accounting
and Reporting Procedures set forth in Exhibit B. This election
shall be made once for each Monoclonal Antibody and shall apply
to the Licensed Product, and all Additional Products, containing
such Monoclonal Antibody. This election also shall be made once
for each Small Molecule and shall apply to the Licensed Product,
and all Additional Products, containing such Small Molecule.
(b) If the JSC approves a Preclinical Program for a New Molecule or
Clinical Trials for a Licensed Product containing a New Molecule
then, as to such New Molecule and Licensed Products containing
such New Molecule, Dendreon may elect, by giving written notice
within thirty (30) days after such JSC approval, to share
DENDREON/GNE Development Costs and Operating Profits and Losses
in the United States as provided above and in Exhibit B.
2.15 First Monoclonal Product Phase III Results. For the first Monoclonal
Product, the JSC will review the data from the Phase III Clinical
Trial results, and will determine how best to commercialize such
Monoclonal Product or any corresponding Additional Product. The
decision of the JSC under this Section shall be binding on the
Parties.
2.16 First SM Products Phase III Results. For the first SM Product, the JSC
will review the data from the Phase III Clinical Trial results, and
will determine how best to commercialize such SM Product or any
corresponding Additional Product. The decision of the JSC under this
Section shall be binding on the Parties.
2.17 Additional Products and Other Molecules. The JSC shall determine
whether to develop Additional Products, or New Molecules as a Licensed
Product, and whether to continue development of any such Licensed
Products following completion of each stage of Clinical Trials. The
decision of the JSC shall be binding on the Parties.
2.18 Regulatory Filings, Communications and Reports
2.18.1 Rights and Obligations of Dendreon.
(a) Dendreon will be responsible for, and will use Commercially
Reasonable and Diligent Efforts in, preparing and filing, at its
cost, the INDs for the Phase I and Phase II Clinical Trials that
it conducts under this Agreement, and Dendreon will own all such
INDs. Genentech will be responsible for, and will use
Commercially Reasonable and Diligent Efforts in, preparing and
filing, at its cost, (i) the INDs for all other Clinical Trials
conducted under the Agreement and (ii) all comparable Regulatory
Filings for its Licensed Product development activities in the
Territory outside the United States. Genentech will own all such
INDs and Regulatory Filings. In addition, Genentech will own, and
be responsible for preparing and filing, at its cost, all BLAs
and NDAs submitted to obtain Regulatory Approvals for Licensed
Products in the Territory. Notwithstanding the foregoing, if
Dendreon
***Confidential Treatment Requested
20
has elected to share in DENDREON/GNE Development Costs and
Operating Profits and Losses hereunder, the costs of preparing
and filing INDs, BLAs and NDAs in the United States will be
shared in accordance with Exhibit B for such filings and
submissions prepared and filed from the date of such election by
Dendreon.
(b) Prior to Dendreon's submitting any IND, the Parties, through the
Joint Project Team, shall consult with the other Party regarding
the scope and general content of such IND. The Parties will
consult and cooperate in sharing information from their Licensed
Product development activities hereunder that is necessary for
the preparation of such Regulatory Filings. Genentech shall have
the right to review and comment on all INDs in accordance with
specific timelines or other arrangements agreed upon by the Joint
Project Team, and such comments will be given all due
consideration by the other Party. Regulatory documents shall be
centralized and held at the offices of the Party responsible for
such IND filing.
(c) If Dendreon is sharing DENDREON/GNE Development Costs and
Operating Profits and Losses hereunder for a Licensed Product,
prior to filing by Genentech of an IND, BLA or NDA for such
Licensed Product, the Parties, through the Joint Project Team,
shall consult regarding the scope and general content of such
Regulatory Filing. Dendreon shall further have the right to
review and comment upon such Regulatory Filing in accordance with
specific timelines or other arrangements agreed upon by the JPT,
and such comments will be given all due consideration by
Genentech.
(d) Neither Party shall transfer title or otherwise attempt in any
manner to dispose of any such INDs, BLAs, or NDAs for Licensed
Products, or otherwise impair the other Party's rights in such
INDs, BLAs or NDAs, without the prior written consent of the
other Party, except that Genentech shall have the right to
require Dendreon to permit Genentech's sublicensee to reference
or cross-reference any such INDs in connection with a license
granted to such sublicensee in accordance with Section 5.4 below.
2.18.2 Regulatory Filings for Manufacturing.
(a) Genentech will be responsible for preparing and filing any necessary
Regulatory Filings, and obtaining necessary Regulatory Approval, for
the manufacture of Clinical Supply and Commercial Supply in the
Territory. The costs of such Regulatory Filings and Regulatory
Approvals shall be borne by Genentech in the Territory outside of the
United States. The costs of such Regulatory Filings and Regulatory
Approvals in the United States will be borne by Genentech; provided
that if Dendreon has elected to share in the DENDREON/GNE Development
Costs and Operating Profits and Losses for a Licensed Product in
accordance with Section 2.14 above such costs for such Licensed
Product will be shared by the Parties pursuant to Exhibit B.
(b) Dendreon will be responsible for preparing and filing any necessary
Regulatory Filings, and obtaining necessary Regulatory Approval, for
the manufacture of Clinical Supply and Commercial Supply in the
Dendreon Territory, at its sole cost.
21
2.18.3 Cross Reference of Regulatory Filings. Each Party shall have
the right to cross reference, in any regulatory document of such
Party, the INDs, BLAs, and NDAs of the other Party, for the purpose of
conducting Clinical Trials and seeking Regulatory Approval under this
Agreement in the Territory. With respect to the manufacturing of
Licensed Product hereunder, Genentech may prepare and submit to the
FDA a Drug Master File, and with respect to the Dendreon Territory, an
equivalent regulatory file. Dendreon will have the right to rely upon
and to cross reference such Drug Master File, and equivalent
regulatory file with respect to the Dendreon Territory, as required
for conducting Clinical Trials hereunder, and manufacturing, and
clinical trials and other development activity in the Dendreon
Territory.
2.18.4 Regulatory Meetings and Communications.
(a) The Party primarily responsible for conducting a Clinical Trial
hereunder will be responsible for conducting meetings and
discussions, and routine telephone communications with the FDA
related to such Clinical Trial. To the extent practical, a
reasonable number of representatives of the other Party will be
given the opportunity to participate in substantive discussions
and meetings with the FDA which relate to such Clinical Trial.
The Party primarily responsible will have decision making
authority regarding the number of, and which, representatives of
the other Party may attend such meetings, but in any case at
least one representative of the other Party may participate. The
other Party will have the right to give input and comments to
pre-meeting documents and packages that are prepared for FDA
meetings regarding Clinical Trials.
(b) Genentech will be solely responsible for conducting all meetings
and discussions with Regulatory Agencies regarding BLAs and NDAs
in the Territory, including without limitation all pre-BLA
meetings held with the FDA. Dendreon may participate in such
discussions and meetings with the FDA to the extent described in
2.18.4(a) above. Dendreon will not have the right to participate,
however, in discussions or meetings with Regulatory Agencies
regarding Licensed Product being developed or sold by Genentech
in the Territory outside the United States.
(c) Notwithstanding Section 2.18.4(a) and (b) above, the primarily
responsible Party will not be obligated to permit representatives
of the other Party to attend any Regulatory Agency meetings
related specifically to an inspection at such Party's premises by
any Regulatory Agency.
(d) To the extent either Party receives written, or material oral
communication from the FDA relating to a Licensed Product, the
Party receiving such communication shall notify the other Party
of the substance of the communication and provide a copy of any
written communication as soon as reasonably practicable.
2.19 Information. Genentech and Dendreon will disclose and make available
to each other in a timely manner all preclinical and clinical
information concerning Licensed Products known by Genentech or
Dendreon at any time during the Term of this Agreement. During
collaborative Licensed Product development, and co-promotion,
activities hereunder, each Party will use Commercially Reasonable and
Diligent Efforts to disclose to the other Party all significant
information directly related to Licensed Products promptly after it is
learned or its significance is appreciated.
22
2.20 Adverse Drug Events and Complaints. The Parties recognize that the
Party that is the holder of the IND for the applicable Clinical Trials
hereunder, and Genentech as the holder of a BLA or NDA, will be
required to submit information and file reports to various
governmental agencies on compounds under clinical investigation,
compounds proposed for marketing, or marketed drugs. Information must
be submitted at the time of initial filing for investigational use in
humans and at the time of a request for market approval of a new drug.
In addition, supplemental information must be provided on compounds at
periodic intervals and adverse drug experiences must be reported at
more frequent intervals depending on the severity of the experience.
Each Party shall promptly provide to the other Party, in connection
with the collaborative Clinical Program hereunder or as long as
Dendreon is sharing Operating Profits and Losses hereunder, a copy of
any such adverse drug experience reports with respect to serious
adverse events. In addition, the Parties agree to the following
provisions, which may be modified by the Joint Project Team:
(a) Each Party shall provide to the other Party, for initial and/or
periodic submission to Regulatory Agencies, significant
information on Licensed Products from its preclinical laboratory,
animal toxicology and pharmacology studies;
(b) In connection with Clinical Trials under the Clinical Program,
each Party shall report to the other Party within three (3) days
of the initial receipt of a report of any serious adverse
experience (as defined by applicable law or regulation) with the
applicable Licensed Products, or sooner if required for other
Party to comply with regulatory requirements; and
(c) In connection with any marketed Licensed Product for which
Dendreon co-promotes hereunder, Dendreon shall provide to
Genentech (i) a copy within three (3) business days of any
adverse drug experience report it receives with respect to such
Licensed Product, and (ii) shall notify Genentech of any serious
complaint about the quality or efficacy of a Licensed Product
received by it in sufficient detail. Each Party also agrees that
if it contracts with a Third Party for research to be performed
by such Third Party on the Licensed Products, that Party agrees
to require such Third Party to report to the contracting Party
the information set forth in subsections 2.20(a), (b) and (c)
above.
2.21 Other Activities. During the Term of this Agreement, neither Party
shall engage in research or development involving Licensed Products in
the Territory directly or indirectly other than pursuant to this
Agreement. Dendreon shall use commercially reasonable efforts to
coordinate its Licensed Product research and development activities in
the Dendreon Territory, including those activities conducted with its
licensees and sublicensees, so as not to impede research and
development activities under this Agreement, and shall endeavor to
achieve a free flow of information to the JSC about such activities in
the Dendreon Territory. Genentech shall use commercially reasonable
efforts to coordinate its Licensed Product research and development
activities in the Territory conducted outside the United States,
including those activities conducted with its sublicensees, so as not
to impede research and development activities under this Agreement,
and shall endeavor to achieve a free flow of information to the JSC
about such activities in the Territory conducted outside the United
States. Both Parties shall retain full rights to conduct independent
research and development work outside the scope of this Agreement
directly or through Third Parties.
23
2.22 Transfer of Materials. During the collaboration hereunder, each Party
may transfer certain of its proprietary materials to the other Party.
Each Party agrees that it will use such materials of the other Party
only for the purposes of the collaboration hereunder, and will not
transfer such materials to any Third Party without the prior written
consent of the other Party hereunder. Except as expressly provided in
this Agreement, the transfer of any such proprietary materials by one
Party to another shall not be deemed to be a grant of any rights in
the proprietary material. All right, title and interest in and to all
such proprietary materials (and any patent rights relating thereto)
shall remain in the Party transferring such materials. Proprietary
materials made or assembled by a Party during and in furtherance of
the collaboration hereunder, and which are directly related to
Licensed Product, shall be considered jointly-owned proprietary
material. Each Party shall have the right to use such jointly-owned
proprietary materials solely for the purposes of the collaboration
hereunder or for internal research purposes and shall not transfer,
license or sublicense any such proprietary materials to any Third
Party without the prior written consent of the other Party. Any
Collaboration Invention Patent Rights arising from a Party's use of
such proprietary materials shall be owned as provided in Section 8.1.
2.23 Third Party Academic Researchers/Institutions.
(a) The Parties acknowledge that it may be beneficial to the
collaboration hereunder for each Party to transfer certain Trp-p8
reagents, Monoclonal Antibodies, Small Molecules and/or Licensed
Products to academic researchers or governmental research
institutions, under material transfer agreements and
collaboration agreements, for additional research on such
molecules ("Third Party Research Agreements"). The obligations of
the Parties under such Third Party Research Agreements may
include providing such researchers with research quantities of
Trp-p8 reagents, Monoclonal Antibody, Small Molecule or Licensed
Product. The Parties shall agree upon and coordinate all such
Third Party Research Agreements, and amendments or extensions
thereto, and the transfer of Monoclonal Antibodies, Small
Molecules and Licensed Products thereunder, through the Joint
Project Team, in a manner to conserve the available quantities of
the Parties' research materials and to avoid compromise of the
Parties' abilities to fulfill their obligations under the any
Preclinical Plan or Clinical Plan hereunder. Any such Third Party
Research Agreements shall be substantially in the form of a
"Material Transfer Agreement" or "Research Collaboration
Agreement" to be agreed upon by the Parties. Each Party agrees to
promptly provide the other Party with all data, reports and
information that such Party receives under such Third Party
Research Agreements.
(b) In the event that research conducted under any Material Transfer
Agreement or Research Collaboration Agreement, entered into by
one or both of the Parties and an academic or governmental Third
Party, results in an invention or know-how made jointly or solely
by a Third Party that relates to Licensed Products, the Parties
24
shall determine whether a license (exclusive or non-exclusive)
can and should be obtained under the rights of such Third Party
to such invention or know-how. If the Parties agree that such
license can and should be obtained, then the Parties will enter
into a license agreement to jointly license such rights.
Milestone payments and royalties payable to a Third Party, due to
such a license granted pursuant to a Material Transfer Agreement
or Collaboration Agreement, shall be chargeable in full to the
collaboration as Cost of Sales in accordance with Exhibit B. If
the Parties do not share DENDREON/GNE Development Costs and
Operating Profits and Losses under this Agreement or if a
milestone payment is due prior to the initiation of such sharing,
then any such milestone payments and royalties will, unless the
Parties agree otherwise, [...***...].
2.24 Contracts with Third Parties. In addition to agreements made with
academic researchers and governmental research institutions as
provided in Section 2.23 above, during the Term the Parties may
jointly or individually enter into written contracts with other Third
Parties for activities to be performed in furtherance of the
activities of the Parties hereunder, including, without limitation,
Third Party consultants and clinical investigators. Each such contract
shall incorporate the confidentiality obligations required under
Section 11.1 below. In addition, Dendreon and Genentech each shall use
commercially reasonable efforts to require, as an obligation under
such contracts, that: (a) such Third Party consultants assign to
Dendreon and Genentech as joint owners all inventions made by such
consultants during the course of their consulting services, and (b)
such Third Party clinical investigators assign to Dendreon and
Genentech as joint owners, or grant an option to Dendreon and
Genentech to co-exclusively license, all inventions made by such
clinical investigators during the course of conducting clinical trials
hereunder.
3. Joint Steering Committee.
3.1 Joint Steering Committee. The Parties hereby establish a Joint
Steering Committee, or JSC, to oversee and direct the Product
Development Program for Monoclonal Products and SM Products as
provided in this Agreement. During the Preclinical Programs for
Monoclonal Products and SM Products, each Party, through the JSC, will
review the periodic information and reports of the other Party
hereunder, and will be able to have input and offer suggestions
regarding the Preclinical Program of the other Party. The JSC shall be
comprised of up to three (3) representatives of each Party, who shall
be appointed (and may be replaced at any time) by such Party on
written notice to the other Party in accordance with this Agreement.
Such representatives shall include individuals within the senior
management of each Party with expertise in drug development and
commercialization. Any member of the JSC may designate a substitute to
attend and perform the functions of that member at any meeting of the
JSC. The Parties shall designate the members of the JSC within twenty
(20) days after the Effective Date of this Agreement. The JSC shall
have the following authority and obligations with respect to Licensed
Products:
(a) To approve the overall strategy for, and to review and approve,
the Product Development Program and Clinical Plans for Monoclonal
Products and SM Products (with respect to SM Products, upon
exercise of Genentech's SM Product option) and their related
budgets.
***Confidential Treatment Requested
25
(b) To provide direction to the Joint Project Team as provided
herein, and to review and approve all activities delegated
to the JPT under this Agreement.
(c) To oversee and approve the activities of the Parties
required to perform the Product Development Program.
(d) To evaluate the results of the Preclinical and Clinical
Programs for Monoclonal Products and SM Products.
(e) To review and approve the selection by the Joint Project
Team of development decision criteria, and of indications
for which Licensed Products are developed.
(f) To perform such other functions as set forth in this
Agreement or as appropriate to further the purposes of this
Agreement and the development of Licensed Product as
determined by the Parties.
3.2 JSC Meetings.
3.2.1 Meeting Schedule. The JSC shall act at meetings held
regularly on reasonable notice during the Term of this Agreement, but
no less often than two (2) times per year or more often as agreed by
the JSC. At least one (1) meeting annually must be conducted in
person. The balance may be conducted by telephone or videoconference
or other acceptable electronic means.
3.2.2 JSC Chair. The JSC shall appoint one of the representatives
of a Party to chair its meetings for a term of six (6) months. The
term of an incumbent chair may not be extended and the successor shall
be appointed from among the representatives of the other Party. The
Chair shall coordinate and prepare the agenda with input from the
other Party, and insure the orderly conduct of the JSC meetings. The
Party hosting the JSC meeting shall appoint one person (who need not
be a member of the JSC) to record the minutes of the meeting in
writing. Such minutes shall reflect the matters discussed and the
actions taken at the meetings. A copy of the minutes shall be provided
to each Party promptly following a meeting for review and comment. Any
modifications to a Clinical Plan (including the work, budget and
timeline therefore) approved at a JSC meeting shall be considered
approved and shall constitute an amendment to the Clinical Plan upon
JSC ratification of the meeting minutes related thereto.
3.3 Decision-Making and Issue Resolution. All decisions of or actions
taken by the JSC shall be taken at a duly called meeting. The
representatives from Dendreon will collectively have one vote and the
representatives from Genentech will collectively have one vote in
decisions, with decisions made by unanimous vote. The vote shall be
reflected in the minutes of the meeting at which it was taken. If the
JSC fails to reach agreement on an issue needing resolution, the
matter shall be resolved by the Parties under the terms of Section
12.9.1 below. The JSC may act on a specific issue without a meeting if
it is documented in a written consent signed by all of the members of
the JSC.
26
4. Joint Project Team.
4.1 Establishment of Joint Project Team. The Parties shall establish a
Joint Project Team (JPT) at the time that the decision is to be made,
as determined by the JSC, to select the first lead Monoclonal
Antibodies or Small Molecules, as the case may be, to place into the
Developmental Research phase of the Product Development Program. The
JPT shall coordinate all activities for the Developmental Research and
Clinical Program for Licensed Products (including SM Products if
Genentech exercises its option under Section 2.6above) in the Field in
the United States, including post-Regulatory Approval development
studies. Each Party shall appoint representatives to the JPT and the
JPT shall consist of such number of representatives of each Party as
are reasonably necessary to accomplish the goals of the JPT hereunder.
The number of such representatives may change from time to time. Such
representatives will include, without limitation, individuals with
expertise and responsibilities in the areas of clinical development,
process sciences, regulatory affairs, product development and
marketing, as applicable to the stage of development of the Licensed
Product. One such representative from each Party shall be designated
as that Party's "Project Team Leader" to act as the primary Joint
Project Team contact for that Party. Either Party may replace any or
all of its representatives at any time upon written notice to the
other Party. Any member of the Joint Project Team may designate a
substitute to attend and perform the functions of that member at any
meeting of the Joint Project Team. The Joint Project Team will meet as
provided in this Agreement or as otherwise agreed by the Joint Project
Team or the JSC.
4.2 Joint Project Team Responsibilities. The Joint Project Team shall be
responsible for:
(a) formulating the overall Clinical Program and the initial and
subsequent annual Clinical Plans and related annual budgets in
accordance with the schedule set forth in Sections 2.9 or as
otherwise determined by the JSC;
(b) formulating life cycle plans, full product development plans, and
Commercialization Plans;
(c) making overall decisions regarding the priority and design of all
Clinical Trials for new indications;
(d) developing a publication strategy and a calendar of key
scientific and clinical meetings and other events for Licensed
Products;
(e) exchanging information and facilitating cooperation and
coordination between the Parties as they exercise their
respective rights and meet their respective obligations under
this Agreement;
(f) determining the priority with respect to seeking Regulatory
Approval of Licensed Products; and
(g) implementing all activities approved by the JSC.
In addition, the Joint Project Team may designate subteams as
appropriate to facilitate coordination and cooperation in key areas.
Specifically, the Joint Project Team will designate a Joint Regulatory
Subteam to coordinate efforts as may be necessary for IND filing and
other regulatory activities.
27
4.3 Joint Project Team Decision-making. As a general principle, the Joint
Project Team will operate by consensus. In the event that the Joint
Project Team members do not reach consensus with respect to a matter
that is within the purview of the Joint Project Team herein, the Joint
Project Team representatives of Dendreon shall collectively have one
vote and the representatives of Genentech one vote for purposes of
decision-making hereunder with respect to such matters, with decisions
made by unanimous vote. If the Joint Project Team is unable to resolve
a dispute regarding a matter within the purview of the JPT, such
dispute shall be resolved by the JSC.
4.4 Ceasing of Joint Project Team Operations. The Joint Project Team will
cease operations and have no further function hereunder on the later
of (i) the date on which the Parties are no longer developing or
commercializing any Licensed Product hereunder or (ii) if applicable,
the date on which the Parties are no longer sharing Dendreon/GNE
Development Costs or Operating Profits or Losses with respect to any
Licensed Product in the United States.
4.5 Annual Production Requirements. The Joint Project Team shall be
responsible for submitting annual Licensed Product supply requirement
reports to the JSC for approval. Such reports shall include the
forecasted requirements for Clinical Supply, Commercial Supply and
Licensed Product placebo, pursuant to the Clinical Supply Agreement
and Commercial Supply Agreement to be entered into by the Parties in
accordance with Sections 7.9.2 and 7.9.3 hereof, and any other related
information requested by the JSC. Each such report shall be submitted
to the JSC with the annual Clinical Plan or Commercialization Plan and
respective budget for each Licensed Product for the subsequent
calendar year.
5. Licenses and Rights.
5.1 Dendreon Grant.
(a) Dendreon hereby grants to Genentech an exclusive license under
Dendreon Patent Rights and Dendreon Know-how, and Dendreon's
rights under Joint Patent Rights, to use, make, have made, sell,
offer for sale and import Trp-p8 and Licensed Products (other
than SM Products and Licensed Vaccine Products) in the Field in
the Territory. Such license shall be co-exclusive with Dendreon
with respect to the use of Trp-p8 and such Licensed Products in
the United States in Preclinical and Clinical Programs hereunder.
In the event that the JSC approves Dendreon conducting its
Preclinical Program activities or any Clinical Trials in any
country in the Territory outside of the United States, then such
license to use such Licensed Products shall be co-exclusive with
Dendreon with respect to those activities in such country. In the
event that Dendreon co-promotes any Licensed Product pursuant to
Section 7.2 below, then such license shall also be co-exclusive
with Dendreon with respect to the sale or offer for sale of such
Licensed Products in the Field in the United States.
(b) Dendreon hereby grants to Genentech a nonexclusive license
without right of sublicense under Dendreon Patent Rights and
Dendreon Know-how, and Dendreon's rights under Joint Patent
Rights, to use, make and have made Small Molecules and SM
Products in the Field in the United States from the Effective
Date until the completion of the SM Product Preclinical Program
under this Agreement.
28
(c) Effective upon Genentech's exercise of its SM Product option
rights in accordance with Section 2.6 above, Dendreon hereby
grants to Genentech an exclusive license under Dendreon Patent
Rights and Dendreon Know-how, and Dendreon's rights under Joint
Patent Rights use, make, have made, sell, offer for sale and
import Small Molecules and SM Products in the Field in the
Territory. Such license shall be co-exclusive with Dendreon with
respect to: (i) the use of SM Products in the United States in
Clinical Trials, and (ii) in the Preclinical Program for SM
Products if Genentech exercises its option prior to the
completion of such Preclinical Program. In the event that
Dendreon conducts any JSC approved SM Product Clinical Trials in
any country in the Territory other than the United States, then
such license for the use of such SM Product shall be co-exclusive
with Dendreon with respect to those Clinical Trials in such
county. In the event that Dendreon co-promotes any SM Product
pursuant to Section 7.2 below, then such license shall also be
co-exclusive with Dendreon with respect to the sale or offer for
sale of such SM Product in the Field in the United States.
(d) Effective upon execution of an agreement between Dendreon and
Genentech pertaining to Licensed Trp-p8 Vaccine Products pursuant
to Section 2.7 above, Dendreon hereby grants to Genentech a
co-exclusive license under the Vaccine Product Patent Rights and
Vaccine Product Know-how, and Dendreon's rights under Joint
Patent Rights to use, make, and have made, offer for sale, sell
and export Licensed Trp-p8 Vaccine Products in the Field in the
Territory.
5.2 Genentech Grant.
(a) Genentech hereby grants to Dendreon a nonexclusive license to use
(and to make and have made during Dendreon's Discovery Research
and Developmental Research) Monoclonal Antibodies, Monoclonal
Products, Small Molecules and SM Products under Genentech Patent
Rights, Genentech Know-how in the United States for the purpose
of carrying out Dendreon's activities under the Preclinical Plans
and Clinical Plans under this Agreement. Genentech also hereby
grants to Dendreon a license, co-exclusive with Genentech, under
Genentech Patent Rights, Genentech Know-how, and Genentech's
rights under Joint Patent Rights to sell and offer for sale
Licensed Products in the Field in the United States, but only to
the extent that Dendreon co-promotes any Licensed Product in the
United States pursuant to Section 7.2 below.
(b) Genentech hereby grants to Dendreon a nonexclusive royalty
bearing license with right of sublicense through multiple tiers
of sublicensees under Genentech Patent Rights, Genentech Know-how
and Genentech's interest in the Joint Patent Rights to use, sell,
offer for sale and import Licensed Products in the Field in the
Dendreon Territory.
(c) For clarification, the license rights granted under this Section
5.2 do not include any right under Genentech Patent Rights or
Genentech Know-how to make products other than Small Molecules,
SM Products, Monoclonal Antibodies, and Monoclonal Products as
granted in 5.2(a) above.
29
5.3 Dendreon Sublicense Rights. Dendreon may sublicense its co-exclusive
license rights granted under Section 5.2(b) above through multiple
tiers of sublicensees to enable its sublicensees to use sell, offer
for sale and import Trp-p8 and Licensed Products in the Dendreon
Territory.
5.4 Genentech Sublicense Rights.
(a) Genentech shall have the right to sublicense the license rights
to Licensed Products (other than SM Products) granted to it under
Section 5.1 above, through multiple tiers of sublicensees, in the
Territory outside of the United States without the consent of
Dendreon. Upon exercise of its option under Section 2.6,
Genentech shall also have the right to sublicense the license
rights to SM Products granted to it under Section 5.1 above,
through multiple tiers of sublicensees, in the Territory outside
of the United States without the consent of Dendreon.
(b) With respect to sublicensing within the United States, following
the [...***...] and payment of the associated milestone as
provided in section 6.2, Genentech shall have the right to
sublicense the license rights granted to it under Section 5.1(a),
through multiple tiers of sublicensees, in the United States,
without the consent of Dendreon, to a Third Party with product
revenues and product development experience similar to that of
Genentech at the time of the execution of this Agreement.
(c) Following Genentech's exercise of its option for SM Products as
provided in Section 2.6 and the decision of the JSC to proceed to
Clinical Trials for an SM Product, Genentech shall have the right
to sublicense the license rights granted to it under Section
5.1(c), through multiple tiers of sublicensees, in the United
States, without the consent of Dendreon, to a Third Party with
product revenues and product development experience similar to
that of Genentech at the time of the execution of this Agreement.
(d) With respect to either Monoclonal Product(s) or SM Product(s), if
a potential Third Party sublicensee does not meet these revenue
and experience criteria in Sections 5.4(b) and 5.4(c), Genentech
shall have the right to sublicense its rights under Section
5.1(a) and (c), through multiple tiers of sublicensees, with the
prior written consent of Dendreon, which consent shall not be
unreasonably withheld or delayed.
(e) With respect to Licensed Trp-p8 Vaccine Products, the rights, if
any, of Genentech to sublicense shall be set forth in the written
agreement of the parties for Licensed Trp-p8 Vaccine Products
described in Section 2.7 above.
5.5 Sublicensee Obligations. If any Party grants a sublicense in the
Territory as permitted under this Agreement, all of the terms and
conditions of this Agreement shall apply to the sublicensee to the
same extent as they apply to such Party for all purposes. The
sublicensing Party assumes full responsibility for the performance of
all obligations so imposed on such sublicensee, including, without
limitation, all payments due under this Agreement by reason of the
operation of any such sublicense. Such sublicense shall not constitute
a novation of this Agreement or otherwise relieve the sublicensing
Party from obligations under this Agreement.
***Confidential Treatment Requested
30
5.6 Trademark License. Genentech hereby grants to Dendreon, a co-exclusive
(co-exclusive with Genentech), non-transferable, non-sublicenseable
license and right to use the Product Trademarks solely within the
United States and solely in connection with Dendreon's Licensed
Product development, and co-promotion of Licensed Product if
applicable, under this Agreement.
5.7 Exclusions. Other than as provided in this Article 5 or Article 8
below, this Agreement does not provide, nor shall it be interpreted,
construed or otherwise deemed to imply or provide, either Party with
any additional grants, licenses, options or other rights under the
Dendreon Patent Rights, Genentech Patent Rights, Joint Patent Rights,
Collaboration Inventions or to Know-how, or to any rights to any other
patents, know-how or proprietary technology or materials of the other
Party.
6. Payments.
6.1 Equity Investment. In consideration of this Agreement, the Parties
will enter into an Equity Investment Agreement of even date herewith
by which Genentech will purchase $2 million in common stock of
Dendreon within ten (10) working days of the Effective Date.
6.2 Additional Equity Investment. Within thirty (30) days after the
[...***...] that binds to Trp-p8 on intact cells, Genentech shall pay
Dendreon a non-refundable fee of $2.5 million through the purchase of
Dendreon common stock on the terms set forth in the Equity Investment
Agreement. For purposes of this Section 6.2 an [...***...] means the
[...***...]. In the event that Dendreon is acquired by a Third Party,
by merger, consolidation, purchase or otherwise prior to such $2.5
million fee becoming payable hereunder, Genentech, as its sole option,
may elect to pay such $2.5 million fee in cash in lieu of such equity
investment.
6.3 Monoclonal Product Milestones. Subject to the other terms and
conditions of this Agreement, Genentech will pay Dendreon the
following milestone payments for Monoclonal Products:
***Confidential Treatment Requested
31
(a) FDA acceptance of first IND filing for the first Monoclonal [...***...]
Product
(b) Upon the first determination by the FDA in a pre BLA meeting that [...***...]
the FDA will consider the first BLA for the first Tumor Type in a
Prevalent Cancer filed based upon data from a Pivotal Trial
(c) Acceptance by the FDA of the first BLA based upon data from a [...***...]
Pivotal Trial for the first Monoclonal Product
(d) Administration of investigational Monoclonal Product to the first [...***...]
subject in the first Phase III Clinical Trial in the United
States for each Tumor Type in a Prevalent Cancer or for the first
Pivotal Trial in the United States for a Monoclonal Product for
the second or any subsequent Tumor Type in a Prevalent Cancer
(e) Notice from the FDA of its acceptance for review of the first BLA [...***...]
based upon data from a Phase III Clinical Trial for the first
Monoclonal Product
(f) First Commercial Sale of the first Monoclonal Product in the [...***...]
first Tumor Type approved in the United States
(g) First Commercial Sale in the United States of a Monoclonal [...***...]
Product approved for second Tumor Type that is a Prevalent Cancer
(h) First Commercial Sale in the United States of a Monoclonal [...***...]
Product approved for a third Tumor Type that is a Prevalent
Cancer
Milestone payment (b), however, will be paid only in lieu of milestone
payment (d) as to the first Monoclonal Product in the first Tumor Type
and only in the event that no Phase III Clinical Trial is conducted
for that first Monoclonal Product in the first Tumor Type because the
Phase II Clinical Trial for such Monoclonal Product is a Pivotal
Trial. Milestone payment (c) will be paid only in lieu of milestone
payment (e), and only in the event that the FDA accepts the first BLA
for such first Monoclonal Product based upon such Pivotal Trial data.
***Confidential Treatment Requested
32
In the event that the BLA based on such Pivotal Trial is not
ultimately accepted by the FDA, or does not result in Regulatory
Approval by the FDA of such first Monoclonal Product in the first
Tumor Type, and a Phase III Clinical Trial is ultimately conducted for
the first Monoclonal Product in the first Tumor Type, then the
following provisions apply: (i) If a Phase III Clinical Trial is
ultimately commenced for such first Monoclonal Product in the first
Tumor Type after milestones (b) and (c) have been paid by Genentech,
but the BLA filing based on such Pivotal Trial for such Monoclonal
Product did not result in Regulatory Approval by the FDA, then
milestone (d) for such Phase III Clinical Trial will not be paid by
Genentech; (ii) If a Phase III Clinical Trial is ultimately commenced
for such Monoclonal Product in the first Tumor Type after milestone
(b) has been paid by Genentech but the BLA filing based on the Pivotal
Trial for such Monoclonal Product was not accepted by the FDA and
milestone (c) therefore not paid, milestone (d) for such Monoclonal
Product shall be reduced to [...***...].
6.4 SM Product.
6.4.1 As consideration for the option granted in Section 2.6,
Genentech shall pay Dendreon the sum of $1,000,000 within ten (10)
business days of the execution of this Agreement.
6.4.2 As the fee to exercise the SM Product option provided in Section
2.6, Genentech shall pay to Dendreon the sum of [...***...] within ten
(10) business days of its delivery to Dendreon of Genentech's notice
of exercise of the option under Section 2.6.
6.4.3 Subject to the other terms and conditions of this Agreement,
Genentech shall pay Dendreon the following one time milestone payments
upon the first occurrence of such event with respect to the first SM
Product to achieve the relevant milestone:
Administration of investigational SM Product to the first subject in [...***...]
first Phase II Clinical Trial in the United States
Administration of investigational SM Product to the first subject in
the first Phase III Clinical Trial in the United States for a [...***...]
Prevalent Cancer
Notice from the FDA of its acceptance of the first NDA for a SM
Product. If the notice follows a Pivotal Trial, the milestone shall be [...***...]
increased by [...***...]
First Commercial Sale of SM Product in the United States [...***...]
***Confidential Treatment Requested
33
6.5 Royalties to Dendreon.
(a) If Dendreon elects to pay [...***...] of Phase III Clinical Trial
Costs for a Licensed Product (other than Licensed Trp-p8 Vaccine
Products) as provided in Section 2.14, then Dendreon and
Genentech shall share the Operating Profits and Losses (as such
terms are defined in Exhibit B hereto) for such Licensed Product
in the United States [...***...] to Dendreon and [...***...] to
Genentech in accordance with Exhibit B. In the event that, with
respect to a Licensed Product, Dendreon does not elect to make
such payment and share in the Operating Profits and Losses above,
then Genentech shall pay to Dendreon a royalty of [...***...] of
Net Sales of such Licensed Product by Genentech and its
sublicensees in the United States. In all cases, Genentech shall
pay to Dendreon a royalty of [...***...] of Net Sales of Licensed
Products by Genentech and its sublicensees in countries in the
Territory other than the United States. Such royalty obligations
shall terminate in accordance with Section 10.1(a).
(b) If royalty payments are to be paid to Dendreon pursuant to
Section 6.5(a) above, and the sale of a Licensed Product by
Genentech in any country in the Territory requires the payment of
royalties to a Third Party, then Genentech shall have the right
to deduct an amount up to [...***...] of such royalties actually
paid to such Third Party from its royalty obligation to Dendreon
hereunder, provided, however, that in no event shall the royalty
to Dendreon for such Licensed Product be reduced below
[...***...] (the "Floor"); provided, however, that the Floor
shall be [...***...] if Dendreon does not fulfill its obligation
hereunder to complete Phase I and Phase II Clinical Trials for
the Licensed Product for which the royalty payment is made.
6.6 Royalties to Genentech. Dendreon shall pay to Genentech a royalty of
[...***...] of Net Sales of Licensed Products (other than Licensed
Trp-p8 Vaccine Products) by Dendreon, its licensees and sublicensees
in the Dendreon Territory. Such royalty obligation shall terminate in
accordance with Section 10.2
6.7 Currency and Payments. All milestone and royalty payments due to the
other Party hereunder shall be made in cash within thirty (30) days of
the applicable milestone, or, with respect to royalties, quarterly
within sixty (60) days after the last day of each calendar quarter,
all in U.S. dollars by means of wire or electronic transfer to the
other Party's account in a bank in the United States to be designated
by the other Party. All associated bank wire charges shall be borne by
the payee. When conversion of payments from any foreign currency is
required, such conversion shall be at an exchange rate equal to the
average of the rates of exchange for the currency of the country from
which the royalties are payable as published by ▇▇▇▇▇▇'▇ (or if not
available, by Bloomberg, L.P.) for the quarterly period for which a
payment is due.
6.8 Royalty Reports. Each royalty payment shall be accompanied by a report
summarizing in suitable detail as determined by the JSC the Net Sales
of Licensed Product during the relevant three-month period.
***Confidential Treatment Requested
34
6.9 Books and Records. Each Party shall keep accurate and complete
accounting information, reports and other records, along with
supporting documentation as necessary for the proper determination of
amounts due to the other Party under this Agreement. Such records
shall be maintained for at least four (4) years after the date of the
payment to which the records relate.
6.10 Audit Rights. Each Party, upon reasonable advance notice to the other,
shall permit a certified public accountant reasonably acceptable to
the audited Party to have access, during ordinary business hours once
each calendar year, to such records under Section 6.9 as may be
necessary to determine the accuracy of any amounts due by the audited
Party under Sections 6.5 or 6.6, as applicable. The auditor shall be
required to maintain all information obtained in the course of the
audit as Confidential Information and report to the other Party only
that information necessary to verify the calculation of amounts due.
The audited Party shall be copied with any information provided by the
auditor to the Party initiating the audit. Any under-payment or
over-payment of amounts due to a Party shall be promptly paid or
refunded as the case may be. The Party initiating the audit shall be
solely responsible for the expenses of the audit unless the audit
determines that with respect to the total amounts paid to the
initiating Party during a calendar year, the initiating Party was
underpaid by five percent (5%). In that event, the audited Party shall
promptly reimburse the initiating Party for the expenses of the audit.
6.11 Blocked Currency. In each country where the local currency is blocked
and cannot be removed from the country, royalties accrued in that
country shall be paid to the receiving Party in the country in local
currency by deposit in a local bank designated by the receiving Party.
6.12 Taxes. The receiving Party shall pay any and all taxes levied on
account of such payments it receives under this Agreement. If laws or
regulations require that taxes payable by the receiving Party be
withheld, the other Party shall (i) deduct those taxes from the
remittable payment, (ii) timely pay the taxes to the proper taxing
authority, (iii) send proof of payment to and receipt by the taxing
authority to the receiving Party.
7. Commercialization in the Territory
7.1 Commercialization - General Roles.
(a) Provided that Dendreon is sharing in Operating Profits and Losses
with respect to Licensed Product as provided in Section 2.14,
then the provisions of this Section 7.1 through 7.7 shall apply
with respect to such Licensed Product. In such event, the JSC
shall have the responsibility and authority to (i) approve
commercialization strategy plans and (ii) monitor, review and
approve the budget and costs incurred in commercialization
activities. The JPT shall have the responsibilities set forth in
Section 4.2 and the responsibility for branding and trademark
strategy, developing Clinical Trial plans for post-approval
Clinical Trials, and review and approval of overall
commercialization budgets and costs.
35
(b) Genentech has established the infrastructure and expertise for
the marketing and sales of therapeutic drugs. Whether or not
Dendreon is co-promoting Licensed Product pursuant to Section 7.2
below, Genentech shall have the responsibility for the design and
implementation of product launch activities and, subject to
Section 7.2 below, the promotion, marketing and sales of Licensed
Products in the United States. Dendreon shall have input on the
overall commercialization and promotion strategy and related
overall budgets in the United States through the JSC and JPT as
provided herein.
(c) If Dendreon is not sharing in Operating Profits and Losses for
Licensed Product under Section 2.14, then Genentech will have
full and sole responsibility and decision making authority for
all commercialization activities in the United States with
respect to such Licensed Product. Whether or not Dendreon is
sharing in Operating Profits and Losses or co-promoting a
Licensed Product hereunder, Genentech shall have the full
responsibility of and decision making for all commercialization
activities in the Territory outside of the United States. In
either case in this Section 7.1(c), the JSC and JPT will have no
oversight or responsibility for such commercialization
activities.
7.2 Marketing and Sales by Dendreon. Provided that Dendreon is sharing in
Operating Profits and Losses for a Monoclonal or SM Product and
demonstrates to the reasonable satisfaction of Genentech that Dendreon
has met all of the following conditions, Dendreon shall have the right
to co-promote such Monoclonal or SM Product in the United States: (a)
Dendreon has the capability to adequately co-promote such Monoclonal
or SM Product in that Dendreon has established, at its own cost,
adequate sales infrastructure and personnel (including for example,
and without limiting the foregoing, an adequate sales force, customer
service, etc.); (b) such co-promotion efforts by Dendreon will benefit
the collaboration by resulting in incremental Operating Profits; and
(c) such co-promotion by Dendreon does not create an overly burdensome
impact on Genentech's promotion infrastructure or sales force for such
Monoclonal or SM Product pursuant to an existing or currently proposed
Commercialization Plan. The Parties agree that the determination, to
the reasonable satisfaction of Genentech, that Dendreon has or has not
met these criteria shall be made on a Licensed Product by Licensed
Product basis following good faith discussion between the Parties.
Further, unless Dendreon has entered into an agreement with Genentech
as provided in Section 7.3 below, Dendreon shall not have the right to
co-promote such Licensed Product if: (i) Dendreon is filing or has
filed a BLA or NDA for or is selling a Competing Product, or (ii) is
conducting a Phase III clinical trial evaluating a Competing Product
with endpoints designed to position the Competing Product as a
substitute product for such Licensed Product. For purposes of this
Section 7.2, a "Competing Product" means a product that satisfies both
of the following: (i) it is or will be labeled for the treatment of
the same Tumor Type as the relevant Licensed Product, and (ii) it is
or will be marketed as a substitution for the such Licensed Product in
the United States.
36
7.3 Genentech's Option to Co-Promote Competing Products. If Dendreon
satisfies the criteria in Section 7.2, to the reasonable satisfaction
of Genentech, to co-promote a Monoclonal or SM Product and Dendreon
desires to so co-promote such Monoclonal or SM Product, but Dendreon
is engaged in the development or commercial sale of a Competing
Product(s) (as defined in Section 7.2 above) then Genentech shall have
a right of first refusal to co-promote such Competing Product(s) on
the same terms and conditions and in the same territory as proposed in
a bona fide offer by a Third Party. Dendreon shall provide Genentech
with thirty (30) days written notice of a bona fide offer to so
co-promote, describing the financial and other general terms of such
offer and providing summary information about such Competing Product
sufficient to evaluate the efficacy and safety of such Competing
Product. Genentech shall have thirty (30) days from the date of
receipt of such notice and such information and data to agree to
co-promote the Competing Product(s) upon the financial and other
general terms specified in the notice by giving written notice to
Dendreon. If Genentech elects not to exercise its right of first
refusal, Dendreon shall have one hundred eighty (180) days thereafter
to enter into an agreement with the Third Party upon terms
substantially the same as those described in the notice to Genentech.
In no event may Dendreon enter into such an agreement with a Third
Party on terms that are, considered as a whole, materially less
favorable to Dendreon than those proposed to Genentech above. If
Dendreon has not entered into such an agreement within said one
hundred eighty (180) day period, Dendreon shall not thereafter enter
into an agreement with a Third Party to co-promote a Competing
Product(s) without providing Genentech with a right of first refusal
as described above. If Genentech elects not to enter into an agreement
with Dendreon to co-promote such Competing Product upon such terms, or
as long as Dendreon conducts development of, or sells, such Competing
Product with or without any Third Party, then Dendreon shall not have
the right to co-promote a Monoclonal or SM Product hereunder with
which the Competing Product competes, as defined in Section 7.2 above.
7.4 Commercialization Plans. For each Monoclonal or SM Product, all
commercialization activities in the United States shall be conducted
in accordance with a written five-year commercialization plan and an
annual commercialization plan and budget to be prepared by Genentech
(each a "Commercialization Plan") and approved by the JSC. Within
sixty (60) days after NDA or BLA submission, Genentech shall submit to
the JSC a five year Commercialization Plan, including budget, for the
commercialization of the relevant Licensed Product in the United
States. Thereafter, Genentech shall update such Commercialization Plan
and present the updated plan to the JSC on a yearly basis as follows:
an updated life cycle plan by the end of the first calendar quarter,
an updated three year brand plan by the end of the third calendar
quarter, and an updated annual tactical plan and budget by the end of
the fourth calendar quarter. A Commercialization Plan shall address
all overall activities that contribute to the successful marketing and
commercialization of a Monoclonal or SM Product including, without
limitation, overall budgets, product positioning, pre-launch
preparation, launch of the product, ongoing marketing and commercial
development, and forecasting, promotion, label expansion, regulatory
strategy and the like.
7.5 Commercialization Efforts. Each Party, to the extent that such Party
is participating in the marketing of Monoclonal or SM Products, shall
use Commercially Reasonable and Diligent Efforts in marketing such
Monoclonal or SM Products in the United States in accordance with the
relevant Commercialization Plan.
37
7.6 Additional Genentech Responsibilities. Notwithstanding any
co-promotion of Licensed Product by Dendreon under Section 7.2 and the
activities of the JSC and JPT under Sections 7.1 and 7.4 above,
Genentech shall be responsible for the design of promotional
materials, shall file such promotional materials with the FDA as
required under applicable law, and shall be designated by Dendreon as
the Party responsible for filing such materials. Further, subject to
Section 2.18,Genentech will have primary responsibility for and final
approval of any and all activities that are regulated by FDA
regulations, guidelines or oversight. Genentech will also be solely
responsible for the following activities with respect to a Licensed
Product: sales training, market research, tactical plans, booking
sales, handling all returns, handling all aspects of order processing,
invoicing and collection, receivables, providing customer medical
information, collection of data of sales to hospitals and other end
users, distribution, inventory, data collection and warehousing.
7.7 Commercialization Costs. Except as otherwise provided herein, if
Dendreon has elected to share in Operating Profits and Losses for
Licensed Product pursuant to Section 2.14 above, all costs related to
the commercialization of such Monoclonal or SM Product in the United
States shall be shared by the Parties as provided in Exhibit B.
7.8 Trademarks and Domain Names.
7.8.1 Single Product Trademark. It is the intent of the Parties that a
single product trademark shall be developed for use on and in
connection with Licensed Products in the United States ("Product
Trademark"). Genentech shall develop a Product Trademark for each
Licensed Product before Regulatory Approval of such product in the
United States and shall reasonably consider Dendreon's comments and
suggestions thereon. Genentech shall be responsible for all activities
necessary or desirable to procure and maintain the trademark
registration of such Product Trademark in the United States, and any
other Licensed Product trademarks in each country in the Territory
outside of the United States, and any corresponding domain names and
domain name registrations. Genentech shall exclusively own the Product
Trademark, and any other trademarks, for Licensed Products in all
countries in the Territory and any domain names. If Dendreon is
participating in the Profit/Loss sharing under Exhibit B, the costs
for such procurement and maintenance of trademark and domain name
registration in the United States shall be a Trademark Cost under
Exhibit B.
7.8.2 Acknowledgment of Ownership Rights. Dendreon acknowledges and
agrees that all use of the Product Trademarks hereunder by Dendreon
will inure to the exclusive benefit of Genentech, the owner of Product
Trademarks. Dendreon undertakes to make use of the Product Trademarks
in such a way that the ownership rights of Genentech in said marks
will not be jeopardized or compromised. Dendreon shall not use the
Product Trademarks as all or part of any corporate name, trade name,
trademark, service ▇▇▇▇, certification ▇▇▇▇, collective membership
▇▇▇▇, domain name, or any other designation confusingly similar to the
Product Trademarks in any way that damages the Product Trademarks. If
any application for registration is or has been filed on the behalf of
Dendreon in any country and relates to any ▇▇▇▇ which, in the
reasonable opinion of Genentech, is confusingly similar, deceptive, or
misleading with respect to, or dilutes or in
38
any other way damages the Product Trademarks, Dendreon shall, at
Genentech's request, abandon all use of such ▇▇▇▇ and any registration
or application for registration. If Dendreon declines to do so, the
Party prevailing in any opposition or related proceeding instigated by
Genentech or its authorized representative thereafter in response to
such filing shall be entitled to reimbursement from the other Party
for its costs and expenses, including reasonable attorneys' fees.
7.8.3 Use of Trademark Designations. Dendreon agrees to use its
commercially reasonable best efforts to use the(TM)designation in
conjunction with Dendreon's use of the Product Trademarks as permitted
hereunder within the United States until such time as U.S.
registrations issue. Once the U.S. registrations issue, Dendreon
agrees to use the(R) designation with Dendreon's uses hereunder of the
Product Trademarks.
7.8.4 Infringement of Product Trademarks. Each Party shall notify the
Joint Project Team promptly upon learning of any actual, alleged or
threatened infringement of a Product Trademark applicable to a
Licensed Product in the Territory, or of any unfair trade practices,
trade dress imitation, passing off of counterfeit goods, or like
offenses in the Territory. Genentech shall have the sole and exclusive
right to enforce the Product Trademarks. If the Parties share
Operating Profits and Losses for a Licensed Product, all of the costs,
expenses and legal fees in bringing, maintaining and prosecuting any
action to maintain, protect or defend a Product Trademark for such
Licensed Product in the United States shall be Trademark Costs shared
in accordance with Exhibit B. Any recovery from such action(s) shall
be Other Income, which shall be shared by the Parties in accordance
with Exhibit B. If the Parties are not sharing Operating Profits and
Losses for a Licensed Product in the United States and in all cases of
infringement in the Territory outside the United States, all such
costs with respect to such Licensed Product shall be borne solely by
Genentech and all such recoveries shall be retained solely by
Genentech.
7.9 Manufacture and Supply.
7.9.1 Clinical Supply. Dendreon shall provide or cause to be provided,
at its cost, all Small Molecules for the completion of its Preclinical
Plan. Dendreon may enter into one or more manufacturing and supply
agreement(s) with a Third Party contract manufacturer(s) covering the
manufacture, supply and quality control of such Small Molecules. If an
agreement with a Third Party contract manufacturer will include
Clinical Supply, such Third Party contract manufacturer(s), and
manufacturing and supply agreement, shall be submitted to the JSC for
review and approval prior to execution of such agreement.
7.9.2 Clinical Supply for Monoclonal Antibodies. Genentech shall
provide or cause to be provided, at its cost, all supplies of
Monoclonal Antibodies for the completion of its Preclinical Plan, and
all Clinical Supply of SM Product and Monoclonal Product for all
Clinical Trials hereunder at its sole expense; provided, however, that
Dendreon shall share in the costs of Clinical Supply for Phase III
Clinical Trials for a Monoclonal or SM Product if it elects to share
Dendreon/GNE Development Costs and Operating Profits and Losses for
such Monoclonal or SM Product pursuant to Section 2.14. As shall be
39
addressed in the Clinical Supply Agreement, it is the intention of the
Parties that process development and other activities related to scale
up to manufacture of Commercial Supply of Monoclonal Product and SM
Product in the United States will be completed prior to the
commencement of Phase III Clinical Trials for each Licensed Product.
As long as Genentech is providing Clinical Supply of a SM Product or
Monoclonal Product for Clinical Trials hereunder, Genentech will
supply Clinical Supply of the same SM Product or Monoclonal Product in
amounts agreed upon by the Parties for Dendreon and Dendreon's
licensees' clinical trials in the Dendreon Territory. The detailed
terms of the supply by Genentech of Clinical Supply will be governed
by a manufacturing and supply agreement negotiated in good faith and
entered into between the Parties (the "Clinical Supply Agreement") as
soon as practicable after the execution of this Agreement.
7.9.3 Commercial Supplies. Genentech shall be responsible for
establishing a commercial manufacturing process and for supplying or
causing to be supplied Commercial Supply of SM and Monoclonal
Products, at the scale and in the amounts required to meet demand for
such products in the Territory. As long as Genentech is manufacturing
a Monoclonal or SM Product for commercial sale in the Territory,
Genentech will be responsible for supplying Commercial Supply of such
Monoclonal Product or SM Product for Dendreon and its licensees in the
Dendreon Territory, in quantities to be agreed upon by the Parties.
The detailed terms of the supply by Genentech of Commercial Supply
will be governed by a manufacturing and supply agreement (the
"Commercial Supply Agreement") and a quality assurance/quality control
agreement (the "Quality Agreement"), each negotiated in good faith and
entered into between the Parties prior to the end of the first Phase
III Clinical Trials hereunder. Genentech may enter into a supply
agreement with a Third Party contract manufacturer (which may be the
same manufacturer used by Dendreon for preclinical supplies) covering
the manufacture, supply and quality control of Commercial Supply as
soon as practicable after the JSC has determined that a Phase II
Clinical Trial is a Pivotal Trial or at the end of Phase III Clinical
Trials. A proposed contract manufacturing agreement shall be submitted
to the JSC for review and comment prior to execution. Genentech shall
give reasonable consideration to the views of the Dendreon members of
the JSC with respect to the selection of the contract manufacturer and
the financial and other terms of the agreement, but the final decision
on contract manufacturer and such contract terms shall be made by
Genentech.
7.9.4 Cost for Dendreon Territory. The costs to Dendreon for Clinical
and Commercial Supply of Monoclonal Product and SM Product in the
Dendreon Territory shall be Genentech's Fully Burdened Manufacturing
Costs plus [...***...].
8. Inventions and Infringement.
8.1 Inventorship and Ownership.
8.1.1 Inventorship. Inventorship of Collaboration Inventions shall be
determined in accordance with the U.S. patent laws. Each Party's
patent counsel shall determine inventorship, and in the case of
disagreements regarding inventorship, the Parties shall refer the same
to mutually acceptable outside counsel. All such determinations shall
be
***Confidential Treatment Requested
40
documented to ensure that any patent applications reflect appropriate
inventorship and that inventions and patent rights are assigned to the
appropriate Party under Section 10.8. Each Party will promptly
disclose to the other all Collaboration Inventions made by it during
the Term of this Agreement. Subject to Section 8.1.2 below, as between
the Parties, Dendreon shall own all Dendreon Collaboration Inventions,
Genentech shall own all Genentech Collaboration Inventions, and Joint
Collaboration Inventions shall be jointly owned by Dendreon and
Genentech. Subject to Section 8.1.2 below, Dendreon and Genentech each
shall require all of their respective employees and consultants to
assign all Collaboration Inventions made by them during the Term of
this Agreement to Dendreon or to Genentech, respectively, as the case
may be.
8.1.2 Collaboration Invention Patents. Notwithstanding the foregoing,
and subject to the provisions of Section 10.10 below, any
Collaboration Invention that is the subject of a patent application or
patent and that is made solely by employee(s) or consultant(s) of
Dendreon or solely by employee(s) or consultant(s) of Genentech or
jointly by employee(s) or consultant(s) of both Dendreon and Genentech
shall be jointly owned by Dendreon and Genentech during the Term of
this Agreement; provided, however, that the Party whose employee(s)
were not named inventors shall not assign, license, sublicense,
transfer, or otherwise dispose of or encumber any portion of its
interest in any such jointly owned Collaboration Invention Patent
Rights without the prior written consent of the other Party, which
consent shall be at such other Party's sole discretion Dendreon and
Genentech each shall require all of its employees and consultants to
assign all Collaboration Inventions made by them during the Term of
this Agreement that are the subject of patent applications to Dendreon
and Genentech as joint owners.
8.2 Restrictions on Jointly-Owned Collaboration Inventions. During the
Term of this Agreement, neither Party shall, in the Territory, license
(except to the other Party pursuant to the license grant under Article
5 above), sublicense, assign, dispose of, encumber or otherwise impair
any portion of its interest in any jointly owned Collaboration
Invention, other than as permitted under Article 5 to a permitted
sublicensee hereunder for purposes of such sublicense or to a
Permitted Assignee hereunder, without the prior written consent of the
other Party in its sole discretion.
8.3 Prosecution and Maintenance of Genentech Patent Rights, Dendreon
Patent Rights and Vaccine Product Patent Rights. Genentech shall have
the sole responsibility to file, prosecute, defend and maintain
Genentech Patent Rights worldwide and shall bear all expenses
associated therewith, and Dendreon shall have the sole responsibility
to file, prosecute, defend and maintain Dendreon Patent Rights and
Vaccine Product Patent Rights worldwide and shall bear all expenses
associated therewith.
8.4 Prosecution and Maintenance of Collaboration Invention Patent Rights.
8.4.1 Coordination. The Parties intend to prosecute and manage
Collaboration Invention Patent Rights on a coordinated basis so that
such Collaboration Invention Patent Rights provide the broadest
possible protection for Licensed Products. To that end, the Parties
will share information and each Party will consider the views of the
other Party
41
with respect to the scope of claims and decisions regarding the
prosecution and maintenance of Collaboration Invention Patent Rights,
to the extent possible. The Parties' patent counsel will regularly
review with the Parties the status of all pending applications and
issued patents within Collaboration Invention Patent Rights.
8.4.2 Outside Counsel. Outside counsel mutually acceptable to
Genentech and Dendreon shall have the responsibility to file,
prosecute and maintain Collaboration Invention Patent Rights. Such
outside counsel shall respond to both Parties' reasonable requests for
information about the course of patent prosecution or other
proceedings relating thereto, shall provide both Parties with copies
of all communications relating thereto with a patent office, and shall
reasonably and equally consider comments by both Parties thereon. The
Parties shall cooperate reasonably in the prosecution thereof and
shall share all material information relating thereto promptly after
receipt of such information. Neither Party shall make a submission to
a patent office that could materially affect the scope or validity of
the patent coverage of any Collaboration Invention Patent Rights
without providing a reasonable opportunity to the other Party to
comment upon such submission. Notwithstanding the provisions of
Exhibit B hereto, the expenses for such outside counsel and all
filing, issue, maintenance and other fees and other costs of filing,
prosecution and maintenance of Collaboration Invention Patent Rights
shall be borne by the Parties in equal shares.
8.4.3 SM Products. In the event Genentech does not exercises its
option pursuant to Section 2.6 with respect to SM Products, then,
effective upon the expiration of the option exercise period therein,
Genentech hereby (i) assigns to Dendreon all of its right, title and
interest in and to any Collaboration Invention Patent Rights Covering
Dendreon Collaboration Inventions to the extent that they cover Small
Molecules or SM Products and (ii) will grant to Dendreon a
nonexclusive, world-wide license with right to sublicense through
multiple tiers of sublicensees under Genentech's interest in Joint
Collaboration Inventions and Genentech's Collaboration Inventions to
the extent Covering Small Molecules or SM Products. Such nonexclusive
license shall be royalty-bearing and subject to commercially
reasonable terms to be negotiated by the Parties. Thereafter, Dendreon
shall have the sole responsibility to file, prosecute, defend and
maintain Collaboration Invention Patent Rights to the extent solely
Covering Small Molecules and SM Products using outside patent counsel
in accordance with the terms of Section 8.4.2 and shall bear all
expenses associated therewith. Thereafter, the restrictions set forth
in Section 8.2 shall no longer apply to jointly owned Collaboration
Inventions Covering Small Molecules and SM Products.
8.4.4 Abandonment. If a Party elects not to participate in the filing,
prosecution or maintenance, or to otherwise abandon, any Joint Patent
Rights (the "Abandoning Party") in a country for which the Parties had
agreed to so file and prosecute the Joint Patent Rights, it shall
notify the other Party. Thereafter, the other Party shall have the
right to pursue, at its expense and sole discretion, prosecution or
maintenance of such Joint Patent Rights in the relevant country using
outside counsel in accordance with the terms of Section 8.4.2.
42
8.5 Patent Interferences. In the event that an interference is declared by
the U.S. Patent and Trademark Office (i) between (a) a claim in one or
more patents or patent applications within the Dendreon Patent Rights
and (b) a claim in one or more patents or patent applications within
the Genentech Patent Rights, or (ii) between (a) or (b) above and (c)
one or more patents or patent applications within the Joint Patent
Rights, then the Parties shall in good faith establish within thirty
(30) days of the declaration of such interference or such other time
as agreed upon a mutually agreeable process to resolve such
interference in a reasonable manner in conformance with all applicable
legal standards
8.6 Patent Enforcement.
8.6.1 Notice. Each Party shall promptly notify the other Party in
writing of any alleged infringement of which it becomes aware, of any
intellectual property right licensed or sublicensed to a Party under
this Agreement setting forth the facts of such alleged infringement
known to the reporting Party with reasonable specificity.
8.6.2 Enforcement of Genentech Patent Rights, Dendreon Patent Rights
and Vaccine Product Patent Rights. Genentech shall have the sole
responsibility to enforce Genentech Patent Rights worldwide and shall
bear all expenses associated therewith, and Dendreon shall have the
sole responsibility to enforce Dendreon Patent Rights and Vaccine
Product Patent Rights worldwide and shall bear all expenses associated
therewith. In the event of an alleged infringement of Dendreon Patent
Rights, or in the event of an alleged infringement of Vaccine Product
Patent Rights directly relating to Licensed Trp-p8 Vaccine Products
after Genentech and Dendreon have entered into an agreement as
contemplated in Section 2.7, Dendreon declines to enforce such
Dendreon Patent Rights or Vaccine Product Patent Rights to ▇▇▇▇▇ the
alleged infringement and such infringement causes a loss of net
profits with respect to one or more Licensed Products in the Territory
sold by Genentech or its sublicensees (and Dendreon if co-promoting
hereunder), then Dendreon will reimburse Genentech for [...***...] of
such loss as established by Genentech. Dendreon's reimbursement for
such loss of net profits in any calendar year may first be paid by
deduction from Dendreon's share of Operating Profits for such calendar
year, with any remaining balance to be reimbursed for that calendar
year to be paid to Genentech in cash within the following calendar
year. If Dendreon is not sharing in Operating Profits at the time such
reimbursement is payable to Genentech and in all cases in which
Genentech establishes a loss of net profits in a country in the
Territory other than the United States, Dendreon's reimbursement for
such loss of net profits in any calendar year may first be paid by
deduction from the royalties due to Dendreon under Section 6.5 for
such calendar year, with any remaining balance to be reimbursed for
that calendar year to be paid to Genentech in cash within the
following calendar year.
8.6.3 Enforcement of Collaboration Invention Patent Rights. Upon
notice of an alleged infringement of Collaboration Invention Patent
Rights, the Parties shall discuss in good faith and endeavor to reach
consensus within a reasonable time upon an appropriate course of
action to further the objectives of the Parties under this Agreement.
Notwithstanding such discussions, Genentech shall have the right, but
not the obligation, to take such steps as it shall deem appropriate in
its sole discretion to cause an infringement of a Collaboration
Invention Patent Right to ▇▇▇▇▇, at its own expense and by counsel of
***Confidential Treatment Requested
43
its choice, unless the Parties agree that no such steps are in their
mutual best interests in light of their objectives under this
Agreement. Such steps may include, but are not limited to, commencing
a suit, proceeding or other legal action or initiating licensing
discussions with the alleged infringer. If the infringed patent within
the Collaboration Invention Patent Rights Covers a Licensed Product
and Genentech fails to take commercially appropriate steps to ▇▇▇▇▇
the infringement within four (4) months following the date of the
first discussion between the Parties regarding such infringement, then
Dendreon shall have the right to take such steps as it shall deem
appropriate in its sole discretion to ▇▇▇▇▇ such infringement at its
own expense. If Genentech has commenced negotiations with an alleged
infringer within such four (4) month period, Genentech will have an
additional six (6) months to conclude its negotiation before Dendreon
may take steps to ▇▇▇▇▇ such infringement.
8.6.4 Collaboration Invention Patent Rights related to Small Molecules
or SM Licensed Product. If Genentech does not exercise its option to
SM Products under Section 2.6, Dendreon shall have the sole
responsibility to enforce Collaboration Invention Patent Rights to the
extent Covering solely Small Molecules and SM Products and shall bear
all expenses associated therewith.
8.6.5 Initiating Party for Collaboration Invention Enforcement. The
Party initiating any legal action under Section 8.6.3 shall be termed
the Initiating Party. The other Party shall fully cooperate with the
Initiating Party in any steps taken to ▇▇▇▇▇ infringement, as
applicable. Such cooperation shall include providing access to
documents and personnel, and providing testimony and such other
assistance, as the Initiating Party shall reasonably request, all of
which shall be at the other Party's sole cost and expense. In
addition, such other Party will, at its own expense, join in any such
infringement action taken by the Initiating Party if required in order
to enable such infringement action to be taken. The other Party shall
have the right, at its own expense, to be represented in any such
action by counsel of its choice.
8.6.6 Control of Collaboration Invention Patent Action. The Initiating
Party under Section 8.6.5 shall have full control of the steps taken,
including prosecution of any action, to ▇▇▇▇▇ the infringement;
provided, however, that the Initiating Party shall consider the
interests of the other Party and shall not settle or consent to an
adverse judgment in any action that would have a material adverse
effect on the rights or interest of the other Party without its prior
express written consent. Such consent shall not be unreasonably
delayed or denied. Any damages, including punitive or other
noncompensatory damages actually received from a Third Party shall
first be applied to reimburse the Initiating Party for its incurred
expenses, including reasonable attorney's fees and expert witness
fees, and then to reimburse the other Party for such expenses, if any.
The reimbursement shall first be made from any compensatory damages,
including attorneys' fees and costs recovered. If any balance of the
sum recovered from the Third Party remains, compensatory damages shall
be deemed to be "Other Income/Expense" to the extent the Parties share
Profits and Losses under this Agreement or Net Sales in the event that
Genentech pays royalties to Dendreon in the country in which such
enforcement action was taken. Any noncompensatory damages remaining
shall be the property of the Initiating Party.
44
8.7 Defense of a Claim of Infringement by Licensed Product
8.7.1 Third Party Claims. If a claim of infringement is brought by a
Third Party against a Party on account of the use, sale, offer for
sale or import (the manufacture) of any Licensed Product, the Parties
shall establish a plan for a common defense.
8.7.2 Defense of Claims.
(a) If Dendreon has elected to share in Profit/Losses for a Licensed
Product pursuant to Section 2.14 above and the Third Party has
brought a claim of infringement in the United States, then the
costs of any such action incurred by one or both of the Parties
(including the costs of any judgment, award, decree or
settlement) will be included in Other Operating Income/Expense in
accordance with Exhibit B. If Dendreon has not elected to share
in the Profits/Losses hereunder or the claim for infringement is
in a country in the Territory other than the United States, then
the Party responsible for implementing the plan of defense (the
"Defending Party") shall pay for its expenses incurred and the
other Party shall fully cooperate at its own expense. Cooperation
shall include providing access to documents and personnel,
providing testimony, and providing such other assistance as the
Defending Party reasonably requests.
(b) The Defending Party shall not consent to a judgment or settlement
that would materially impair the financial and other interests of
the other Party under this Agreement without the other Party's
consent, which shall not be unreasonably delayed or denied. If
damages, including punitive or other non-compensatory damages are
paid by the Third Party, they shall first be applied to reimburse
the Defending Party for its incurred expenses, including
reasonable attorney's fees and expert witness fees, and then to
reimburse the other Party for such expenses. Such reimbursement
shall first be made from any compensatory damages, including
attorneys' fees and costs, recovered. If any balance of the sum
recovered from the Third Party remains, compensatory damages
shall be deemed to be "Other Income/Expense" if Dendreon is
sharing Operating Profits and Losses with respect to the Licensed
Product in the country at issue or Net Sales if Dendreon is not.
Any remaining punitive or noncompensatory damages shall be the
property of the Party that was the counterclaim plaintiff on the
counterclaim that resulted in the recovery of damages. If the
proceeding results in a settlement or judgment in favor of the
Third Party, then any license fees or other amounts, including
compensatory and noncompensatory damages, paid to such Third
Party shall be "Other Operating Income/Expense" if the Parties
are sharing Operating Profits and Losses with respect to the
Licensed Product in the relevant country or a deduction from Net
Sales (subject to the limitation in Section 6.5(b)) if they are
not.
8.8 Third Party Patents and Royalties. Except as provided in Section
2.5.4, the Parties shall cooperate to obtain any license(s) under any
Third Party patent(s) that the Parties jointly determine are necessary
or desirable to manufacture, use, sell, offer for sale or import a
Licensed Product in the United States. Any license fees, milestones or
other costs of such license(s) in the United States for a Monoclonal
Antibody, Small Molecule or Licensed Product incurred during the
Preclinical Program for such Monoclonal Antibody, Small
45
Molecule or Licensed Product shall be paid during such Preclinical
Program by Party responsible for the costs of such Preclinical Program
under Sections 2.8.1 and 2.8.2 above. Any license fees, milestones or
other costs of such license(s) for a Licensed Product in the United
States incurred during Phase I and Phase II Clinical Trials for such
Licensed Product shall be shared during such Clinical Trials as the
Parties shall agree until such time as Dendreon elects to share in
DENDREON/GNE Development Costs and Operating Profit and Loss pursuant
to Section 2.14 for such Licensed Product. At that time, any fees,
milestones royalty payments, and other license costs will be included
in Other Operating Income/Expense or Fully Burdened Manufacturing
Costs, as the case may be, in accordance with Exhibit B. If Dendreon
elects not to share in Operating Profit and Loss pursuant to Section
2.14 with respect to such Licensed Product, any royalties payable on
account of such license may be deducted from royalties otherwise due
to Dendreon upon sales of such Licensed Product in the United States,
subject to the limitations in Section 6.5(b). At all times, Genentech
may enter into a license with a Third Party applicable to the
manufacture, use, sale, offer for sale, or import of a Licensed
Product in the Territory outside the United States without the consent
or agreement of Dendreon, and all costs of any such license shall be
borne solely by Genentech; provided however, that royalties payable
under such license may be deducted from royalties due to Dendreon upon
the sale of such Licensed Product in the Territory outside the United
States, subject to the limitations in Section 6.5(b).
9. Representation, Warranties and Indemnities.
9.1 Dendreon's Representations and Warranties. Dendreon represents and
warrants to Genentech the following as of the Effective Date:
(a) Dendreon has all necessary rights, powers and authorities to
enter into this Agreement and to grant to Genentech the license
rights herein.
(b) Dendreon's performance under this Agreement does not conflict
with or create a breach or a default of any law or order of a
court or governmental agency applicable to Dendreon, or any
contract or other obligation of Dendreon to any Third Party.
(c) Dendreon has not, and until the expiration or earlier termination
of this Agreement will not, grant any rights related to Licensed
Products to any Third Party that would conflict with the rights
granted to Genentech hereunder.
9.2 Genentech's Representations and Warranties. Genentech represents and
warrants to Dendreon the following as of the Effective Date:
(a) Genentech has all necessary rights, powers and authorities to
enter into this Agreement.
(b) Genentech's performance under this Agreement does not conflict
with or create a breach or a default of any law or order of a
court or governmental agency applicable to Genentech, or any
contract or other obligation of Genentech to any Third Party.
46
(c) Genentech has not, and during the expiration or earlier
termination of the Agreement will not, grant any rights related
to Licensed Products that would conflict with the rights granted
to Dendreon hereunder.
9.3 Disclaimers. Each Party expressly disclaims and does not represent,
warrant or otherwise covenant to the other Party that:
(a) its rights under the Patent Rights will not be held invalid or
unenforceable (in whole or in part) or that the Patent Rights
will be of any particular scope or that the Patent Rights will be
prosecuted, maintained, defended or enforced; or
(b) its right under the Patent Rights will not be infringed by a
Third Party; or
(c) the exploitation or use by the other Party of the Patent Rights,
including the contemplated commercialization of Patent Rights,
will not interfere with or infringe any patent or other
intellectual property rights of any Third Party; or
(d) the activities or products under this Agreement Covered by the
Patent Rights will give any results in terms of merchantability,
fitness, precision, accuracy, sensitivity, safety, efficacy or
therapeutic, diagnostic or prognostic effect of any kind.
9.4 EXCEPT AS EXPRESSLY SET FORTH HEREIN EACH PARTY DISCLAIMS ALL
WARRANTIES, EXPRESS OR IMPLIED, INCLUDING THE WARRANTIES OF
MERCHANTABILITY OR FITNESS FOR A PARTICULAR PURPOSE OR THAT LICENSED
PRODUCTS WILL NOT INFRINGE ANY PATENTS.
9.5 Dendreon's Indemnities. Dendreon shall defend, indemnify, and hold
harmless Genentech and its officers, directors, employees, and agents
from any and all claims, suits, actions, demands, penalties, fines,
costs, damages, expenses, fees, injuries, liabilities and losses,
including reasonable attorneys' fees incurred to a Third Party
(collectively "Losses") arising out of or related to:
(a) the negligence or willful misconduct, including acts of omission,
by Dendreon relating to this Agreement; or
(b) a material breach by Dendreon of this Agreement or Dendreon's
representations and warranties; or
(c) any failure by Dendreon or its licensees, sublicensees or
contractors (other than Genentech), in the course of conducting
activities under this Agreement, to comply with applicable
governmental laws or regulations; or
(d) the use, handling, storage, distribution, promotion,
manufacturing, marketing, sale or other commercialization of
Licensed Product by Dendreon, its licensees, sublicenses or
contractors (other than Genentech) in the United States and the
Dendreon Territory.
Provided, however, that Dendreon's obligation to indemnify under this
Section 9.5 shall not extend to Losses that arise from the negligence
or willful misconduct of Genentech, its breach of any provision of
this Agreement or its representations and warranties, or the failure
to comply with applicable laws or regulations by Genentech or its
sublicensees or contractors. Further, Dendreon's obligation to
indemnify Genentech under Section 9.5(d)
47
shall not extend to Losses to the extent arising out of activities for
which Genentech is obligated to indemnify Dendreon, if any, under the
Clinical Supply Agreement or Commercial Supply Agreement.
9.6 Genentech's Indemnities. Genentech shall defend, indemnify and hold
harmless Dendreon and its officer, directors, employees and agents
from any and all Losses arising out of or related to:
(a) negligence or willful misconduct, including acts of omission, by
Genentech relating to this Agreement; or
(b) a material breach by Genentech of this Agreement or Genentech's
representations and warranties; or
(c) any failure by Genentech or its licensees, sublicensees or
contractors (other than Dendreon), in the course of conducting
activities under this Agreement, to comply with applicable
governmental laws or regulations; or
(d) the use, handling, storage, distribution, promotion, marketing,
sale or other commercialization of Licensed Product by Genentech
or its licensees, sublicensees or contractors (other than
Dendreon) in the Territory.
Provided, however, that Genentech's obligation to indemnify shall not
extend to Losses that arise from the negligence or willful misconduct
of Dendreon, its breach of any provision of this Agreement or its
representations and warranties, or the failure to comply with
applicable laws or regulations by Dendreon or its sublicensees or
contractors (other than Genentech). In addition, Genentech's
obligations to indemnify Dendreon under Section 9.6(d) shall not apply
to the Losses arising from the use, handling, storage, distribution,
promotion, marketing, sale or other commercialization of a Licensed
Product in the United States if such Losses are charged to the
collaboration in accordance with Section 9.9 below.
9.7 Indemnity Conditions. The indemnification of the Parties above shall
apply only if the following conditions are met. Promptly after
becoming aware of a claim, the indemnified Party shall provide written
notice to the indemnifying Party. Delay in providing such notice shall
relieve the indemnifying Party of its indemnity obligations only if
the indemnifying Party's ability to defend against such claim is
thereby materially impaired. The indemnifying Party shall have the
right to assume and control the defense of the claim at its own
expense. The indemnified Party shall have the right to participate in,
but not to control, such defense at its own expense. If the
indemnifying Party does not assume the defense of the claim, the
indemnified Party may defend the claim at the indemnifying Party's
expense. The indemnified Party shall not settle or compromise the
claim without the prior written consent of the indemnifying Party, and
the indemnifying Party shall not settle or compromise the claim in any
manner that would have a material adverse effect on the indemnified
Party without the prior written consent of the indemnified Party. No
consent required hereunder shall be unreasonably withheld or delayed.
The indemnified Party shall reasonably cooperate with the indemnifying
Party and shall, at the indemnifying Party's expense, make available
to the indemnifying Party all pertinent information in its possession
or under its control.
48
9.8 Insurance. Each Party shall procure and maintain at its own cost
comprehensive general liability (including coverage for products and
maintained for a period of at least five (5) years after the
expiration or termination of this Agreement), product liability,
clinical trial liability, and property and casualty insurance, or
self-insurance, providing commercially reasonable coverage for their
respective activities under this Agreement and their equipment,
premises and businesses. Each Party will maintain foreign local
coverage in the Territory or Dendreon Territory where required by
foreign law in an amount that, at a minimum, satisfies the legal
requirements of that jurisdiction. The insurance policies in the
United States shall be with financially strong insurance carriers (AM
Best Rating of "A: VIII" or higher) and will be primary to any other
insurance owned, secured or in place by such Party. Each Party shall
cause its insurance policies to be endorsed to provide for thirty (30)
days prior written notice to the other by the insurance carrier of
cancellation, expiration or modification of the insurance policy. Each
Party will name the other Party as an additional insured under all
such coverages and will furnish to the other Party the corresponding
certificates of insurance that evidence the foregoing within thirty
(30) days of the Effective Date.
9.9 Other Liabilities. If Dendreon is participating in Operating Profit
and Loss under Exhibit B for a Licensed Product, any Losses resulting
directly or indirectly from the use, handling, storage, distribution,
promotion, marketing, sale or other commercialization of such Licensed
Product in the United States that do not fall within the scope of the
Parties' respective indemnification obligations in Sections 9.5(a),
(b) or (c) or 9.6(a), (b), or (c) shall be charged to the
collaboration as an Other Operating Income/Expense at the time such
Losses are incurred.
10. Term and Termination.
10.1 Term. The Term of this Agreement (the "Term") shall begin on the
Effective Date and, unless earlier terminated as provided in Sections
10.3, 10.4, or 10.5 below, shall end in each country in the Territory,
on a Licensed Product-by-Licensed Product basis, as follows.
(a) Except for those Licensed Products for which Dendreon has elected
to share in DENDREON/GNE Development Costs and Operating Profits
and Losses in the United States under Section 2.14 above, this
Agreement and the royalty obligations of Genentech under Section
6.5 will expire with respect to each Licensed Product upon the
later of (i) ten (10) years after the first commercial sale of
such Licensed Product in such country, or (ii) the expiration of
the last to expire of the issued patents within the Dendreon
Patent Rights or Collaboration Invention Patent Rights Covering a
Dendreon Collaboration Invention in such country that contains a
Valid Claim that Covers such Licensed Product.
(b) If Dendreon has elected to share in DENDREON/GNE Development
Costs and Operating Profits and Losses in the United States with
respect to a Licensed Product under Section 2.14 above, this
Agreement will expire with respect to such Licensed Product in
the United States on the date on which such Licensed Product is
no longer marketed by Genentech or the Parties in such country
and the Parties are no longer entitled to receive a share
Operating Profits and Losses hereunder with respect to such
Licensed Product.
49
(c) Upon the expiration of the term of this Agreement with respect to
a Licensed Product in each country, all licenses to Genentech
hereunder in such country applicable to such Licensed Product
shall become fully paid and irrevocable. Subject to the survival
provisions of Section 10.8 below, after expiration of this
Agreement with respect to a Licensed Product, all obligations of
Dendreon and Genentech hereunder with respect to such Licensed
Product will cease.
10.2 Term of Licenses to Dendreon and Royalties to Genentech. Unless this
Agreement is earlier terminated as provided in Sections 10.3, 10.4 or
10.5 below, the license rights granted to Dendreon in the Dendreon
Territory under Section 5.2(b), and the royalties payable to Genentech
pursuant to Section 6.6-6.12 shall end, on a Licensed Product by
Licensed Product basis in each country in the Dendreon Territory, upon
the later of (a) ten (10) years after the first commercial sale of
such Licensed Product in such country or (b) the expiration of the
last to expire of the issued patents within the Genentech Patent
Rights or Collaboration Invention Patent Rights Covering a Genentech
Collaboration Invention in such country that contains a Valid Claim
that Covers such Licensed Product.
10.3 INTENTIONALLY OMITTED
10.4 Early Termination By Genentech Without Cause.
10.4.1 Termination Following Phase II Clinical Trials. During the
sixty (60) day period following the first Completion of Phase II
Clinical Trials, Genentech, by written notice to Dendreon, may elect
to terminate this Agreement and the Clinical Supply Agreement (and
Commercial Supply Agreement and Quality Agreement, if they have been
entered into) with respect to any or all Licensed Products for any
reason. Such termination shall be effective one hundred twenty (120)
days thereafter and shall be subject to the following conditions:
(a) Genentech shall reimburse Dendreon for all of Dendreon's Clinical
Trial Costs for Phase I and Phase II Clinical Trials for the
Licensed Product(s) terminated.
(b) Upon request by Dendreon within thirty (30) days of receiving
Genentech's termination notice, Genentech shall sell to Dendreon
up to eighteen (18) months of inventory of Clinical Supply of
such Licensed Product(s) manufactured by Genentech, at a price
equal to Genentech's Fully Burdened Manufacturing Costs plus
[...***...]. If, at the date of Dendreon's receipt of such notice
of termination, Genentech's then existing inventory of such
Licensed Product(s) is less than 18 months, Genentech shall
manufacture such Clinichal Supply of Licensed Product(s) to
enable it to deliver, together with the existing inventory, a
total of such eighteen (18) month inventory at such price.
(c) The Parties shall cooperate to ensure an orderly assumption of
sole responsibility by Dendreon for further development of such
Licensed Product(s), to transfer INDs for Licensed Product to
Dendreon, and shall use reasonable efforts during such transition
to minimize adverse impacts upon patients, investigators, and the
Parties.
***Confidential Treatment Requested
50
(d) To the extent it is contractually able to do so, Genentech shall
assign to Dendreon any then-existing Third Party contracts that
govern goods or services solely for such Licensed Product(s) and
that are necessary for the development or sale of such Licensed
Product(s).
(e) Genentech shall extend to Dendreon, promptly following delivery
of its notice of termination, the opportunity to acquire a
license, on commercially-reasonable terms, for: (i) Manufacturing
Know How Controlled by Genentech, existing on the date of
Genentech's termination notice, to the extent it is Know-how
developed specifically to make such Licensed Product(s), (ii)
Genentech Patent Rights existing on the date of Genentech's
termination notice, to the extent solely Covering the manufacture
of such Licensed Product(s), and (iii) Genentech's interest in
Collaboration Inventions developed specifically to make such
Licensed Product. Genentech also shall extend to Dendreon,
promptly following delivery of its notice of termination, the
opportunity to acquire a license for other Genentech Patent
Rights and Know-How Controlled by Genentech directly related to
manufacturing of such Licensed Product(s) and to the extent
necessary to manufacture such Licensed Product(s), but only to
the extent that such licenses are made available to similar Third
Parties for similar products, at that time, and under terms
similar to those offered to such Third Parties which, in any
case, shall be commercially reasonable terms.
(f) The Parties effect the assignments required by Section 10.10 with
respect to such Licensed Product(s).
(g) Effective upon the date of termination Genentech will grant to
Dendreon an exclusive (except as to Genentech), worldwide
royalty-bearing license on commercially reasonable terms, with
the right to sublicense through multiple tiers of sublicense,
under Genentech Patent Rights, Genentech Collaboration Inventions
and Genentech's interest in Joint Patent Rights to the extent
necessary to use, sell, offer for sale and import such Licensed
Product(s) then in existence or thereafter developed.
(h) Dendreon shall have the perpetual right to reference and the
right to rely upon the Regulatory Filings for Licensed Product
made by Genentech.
10.4.2 Termination Following Phase III Clinical Trials. At any time
following the first Completion of Phase III Clinical Trials, Genentech
may, upon written notice to Dendreon, elect to terminate this
Agreement and the Clinical Supply Agreement (and Commercial Supply
Agreement and Quality Agreement, if they have been entered into) for
any or all Licensed Product(s) for any reason. Such termination shall
be effective one hundred twenty (120) days thereafter, and shall be
subject to the following conditions:
(a) The JSC will cause to be developed for approval by the Parties a
final financial statement with respect to such Licensed
Product(s) in accordance with Exhibit B and/or the Parties will
prepare a final royalty report in accordance with Section 6.8, as
applicable.
51
(b) Either Party may exercise any applicable audit rights with
respect to such Licensed Product(s).
(c) The Parties shall cooperate to ensure an orderly assumption of
sole responsibility by Dendreon for such Licensed Product(s) at
the stage of development or commercialization at the time of
termination, to transfer to Dendreon ownership of any Regulatory
Filings for Licensed Product made by Genentech, and to use
reasonable efforts during such transition to minimize any adverse
impact upon patients and the Parties.
(d) Upon request by Dendreon within thirty (30) days of receiving
Genentech's termination notice, Genentech shall sell to Dendreon
its then existing inventory of such Licensed Product(s) for a
price equal to its Fully Burdened Manufacturing Costs
[...***...].
(e) If, on the date of Dendreon's receipt of such notice of
termination, Genentech's then existing inventory is not
sufficient to provide Dendreon a total of eighteen (18) months
inventory of Licensed Product, Genentech shall manufacture such
additional Licensed Product(s) to enable it to deliver, together
with the existing inventory of such Licensed Product, a total of
eighteen (18) months supply of each Licensed Product. The
purchase price shall be Genentech's Fully Burdened Manufacturing
Costs [...***...].
(f) To the extent it is contractually able to do so, Genentech shall
assign to Dendreon any then-existing Third Party contracts that
govern goods or services solely for such Licensed Product(s) and
are necessary for the development or sale of such Licensed
Product(s).
(g) Genentech shall extend to Dendreon, promptly following delivery
of its notice of termination, the opportunity to acquire a
license, on commercially-reasonable terms, for: (i) Manufacturing
Know How Controlled by Genentech, existing on the date of
Genentech's termination notice, to the extent it is Know-how
developed specifically to make such Licensed Product(s), (ii)
Genentech Patent Rights existing on the date of Genentech's
termination notice, to the extent solely Covering the manufacture
of such Licensed Product(s), and (iii) Genentech's interest in
Collaboration Inventions developed specifically to make such
Licensed Product. Genentech also shall extend to Dendreon,
promptly following delivery of its notice of termination, the
opportunity to acquire a license for other Genentech Patent
Rights and Know-How Controlled by Genentech directly related to
manufacturing of such Licensed Product(s) and to the extent
necessary to manufacture such Licensed Product(s), but only to
the extent that such licenses are made available to similar Third
Parties for similar products, at that time, and under terms
similar to those offered to such Third Parties which, in any
case, shall be commercially reasonable terms.
(h) The Parties shall effect the assignments required by Section
10.10 with respect to such Licensed Product(s).
(i) Effective upon the date of such termination, Genentech will grant
to Dendreon an exclusive (except as to Genentech), worldwide,
royalty-bearing license, on commercially reasonable terms, with
the right to sublicense through multiple tiers of sublicense,
under the Genentech Patent Rights, Genentech Collaboration
Inventions and Genentech's interest in Joint Patent Rights to the
extent necessary to use, sell, offer for sale and import such
Licensed Product(s) then in existence or thereafter developed.
***Confidential Treatment Requested
52
(j) Dendreon shall have the perpetual right to reference and right
to rely upon the Regulatory Filings for Licensed Product made
by Genentech under this Agreement.
10.5 Termination for Cause. Notwithstanding the Term, this Agreement and
the licenses granted in Article 5 herein, may be terminated for cause
by either Party as follows.
10.5.1 Material Breach. Either Party (the "Initiating Party") may
terminate this Agreement for material breach by the other Party (the
"Responding Party") on sixty (60) days written notice describing the
nature of the alleged breach unless, within such sixty (60) day
period, the Responding Party cures or takes substantial steps to cure
the alleged breach if it is susceptible to cure. If the alleged
material breach is a failure to timely commence or complete
responsibilities under a Preclinical Plan or for Clinical Trials and
the Responding Party fails to so cure, then the Initiating Party, in
addition to any other remedy it may have, may assume sole
responsibility for the commencement or completion of such Preclinical
Program or Clinical Trials.
10.5.2 Bankruptcy. If a proceeding is commenced against a Party
without the application or consent of the other Party and remains
pending for a period of sixty (60) days that seeks (i) the
liquidation, reorganization, dissolution or winding-up, or the
composition or adjustment of the debts of such Party, (ii) the
appointment of a trustee, receiver, custodian, or the like for such
Party, or (iii) similar relief under any law relating to bankruptcy,
insolvency, reorganization, or the composition or readjustment of
debts, then the other Party may terminate this Agreement upon thirty
(30) days written notice.
10.6 Effect of Termination For Cause Under Section 10.5.
10.6.1 Termination by Genentech. If Genentech terminates this
Agreement for cause under Section 10.5.1 or 10.5.2 then the following
shall apply:
(a) Effective upon the date of termination, Dendreon hereby grants
to Genentech a royalty-bearing license with the right to
sublicense through multiple tiers of sublicense under Dendreon
Collaboration Inventions, Dendreon Patent Rights, and
Dendreon's interest in Joint Patent Rights to make, have made,
use, sell, offer for sale and import Licensed Products in the
Territory in the Field. Such license shall be exclusive (even
as to Dendreon) as to all Licensed Products. Such license shall
bear a royalty of [...***...] and shall be subject to the
provisions of Sections 6.5, 6.7 - 6.12. The term of such
license and royalties shall be that described in Section
10.1(a) above.
(b) The JSC will cause to be developed for approval by the Parties
a final financial statement pursuant to Exhibit B and/or the
Parties shall prepare a final royalty report in accordance with
Section 6.8.
(c) Either Party may exercise any applicable audit rights.
(d) The Parties will effect the assignments required by Section
10.10.
***Confidential Treatment Requested
53
(e) If requested by Genentech, Dendreon shall cooperate to ensure an
orderly assumption of sole responsibility by Genentech for each
Licensed Product(s) at the stage of development or
commercialization at the time of such termination, transfer
ownership or any Regulatory Filings for Licensed Products to
Genentech, and use reasonable efforts during such transition to
minimize any adverse impact upon patients and the Parties
(f) To the extent it is contractually able to do so, Dendreon shall
assign to Genentech any then-existing Third Party contracts that
govern goods or services solely for such Licensed Product(s) and
are necessary for the development or sale of such Licensed
Product(s).
(g) Genentech shall have a perpetual right to rely upon and right to
cross reference any Regulatory Filings for Licensed Product made
by Dendreon under this Agreement.
10.6.2 Termination by Dendreon. If Dendreon terminates this Agreement
for cause under Section 10.5.1 or 10.5.2, then the following shall
apply:
(a) The JSC will cause to be developed for approval by the Parties a
final financial statement pursuant to Exhibit B and/or the
Parties shall prepare a final royalty report in accordance with
Section 6.8.
(b) Either Party may exercise any applicable audit rights.
(c) If requested by Dendreon, Genentech shall cooperate to ensure an
orderly assumption of sole responsibility by Dendreon for each
Licensed Product(s) at the stage of development or
commercialization at the time of such termination, transfer
ownership of any Regulatory Filings made by Genentech for
Licensed Products, and to use reasonable efforts during such
transition to minimize any adverse impact upon patients and the
Parties.
(d) Upon request by Dendreon within thirty (30) days of the effective
date of such termination, Genentech shall sell to Dendreon its
then existing inventory of Licensed Product(s) for a price equal
to its Fully Burdened Manufacturing Costs [...***...].
(e) If, on the effective date of such termination, Genentech's then
existing inventory is not sufficient to provide Dendreon a total
of eighteen (18) months inventory of Licensed Product, Genentech
shall manufacture such additional Licensed Product(s) to enable
it to deliver, together with the existing inventory of such
Licensed Product, a total of eighteen (18) months supply of such
Licensed Product. The purchase price for such Licensed Product
shall be Genentech's Fully Burdened Manufacturing Costs
[...***...].
(f) To the extent it is contractually able to do so, Genentech shall
assign to Dendreon any then-existing Third Party contracts that
govern goods or services solely for such Licensed Product(s) and
are necessary for the development or sale of Licensed Product(s).
(g) Effective upon the date of such termination, Genentech hereby
grants to Dendreon an exclusive (except as to Genentech),
worldwide, with the right to sublicense through multiple tiers of
sublicense, under the Genentech Patent Rights, Genentech
Collaboration Inventions and Genentech's interests in Joint
Patent Rights to the extent necessary to use, sell, offer for
sale and import any Licensed Product then in
***Confidential Treatment Requested
54
existence or thereafter developed. Such license shall bear a
royalty of [...***...] and shall be subject to the provisions of
Sections 6.7-6.12. The term of such l0icense and royalties shall
be that described in Section 10.1(a) above.
(h) Effective upon the date of such termination, Genentech will grant
to Dendreon, on commercially reasonable terms, a nonexclusive
license to make and have made Licensed Products under: (i)
Manufacturing Know-how Controlled by Genentech, existing on the
effective date of such termination, to the extent it is Know-How
developed specifically to make such Licensed Product(s); (ii)
Genentech Patent Rights, then existing, to the extent solely
Covering the manufacture of Licensed Products, and (iii)
Genentech's interest in Collaboration Inventions developed
specifically to make Licensed Product(s). Genentech also shall
extend to Dendreon, on the effective date of such termination,
the opportunity to acquire a license for other Genentech Patent
Rights and Know-how Controlled by Genentech, to the extent
related to manufacturing of such Licensed Product(s) and to the
extent necessary to manufacture such Licensed Product(s), but
only to the extent that such licenses are made available to
similar Third Parties for similar products at that time, and
under terms similar to those offered to such Third Parties which,
in any case, shall be commercially reasonable terms.
(i) Dendreon shall have a perpetual right to cross-reference and
right to rely upon the Regulatory Filings for Licensed Product
made by Genentech under this Agreement.
(j) The Parties will effect the assignments required by Section
10.10.
10.7 No Limitation. The provisions of 10.6.1 and 10.6.2 above shall not
preclude either Party from seeking any other remedy to which it may be
entitled under law or in equity for the material breach of the other
Party, including, without limitation, recovery for damages caused
directly by the material breach of the other Party.
10.8 Survival. Expiration of any termination of this Agreement shall not
relieve the Parties of any obligation that accrued prior to such
expiration or termination. The provisions of Article 9, Section 6.9.
8.1.1, 10.4, 10.6, 10.7, 10.10, 11.1 through 11.5, 12.9, 12.10, and
12.12 shall survive the expiration or any termination of this
Agreement.
10.9 Bankruptcy. All rights and licenses granted under or pursuant to this
Agreement are and shall be deemed to be, for purposes of Section
365(n) of the U.S. Bankruptcy Code, licenses of rights to
"intellectual property" as defined under Section 101 of the U.S.
Bankruptcy Code. The Parties shall retain and may fully exercise all
of its rights and elections under the U.S. Bankruptcy Code; provided
that nothing herein shall be deemed to constitute a present exercise
of such rights and elections.
10.10 Effect of Expiration or Termination on Intellectual Property. Within
thirty (30) days after the expiration or any other termination of this
Agreement by either Party for any reason, including mutual agreement
of the Parties, (but effective immediately prior to such termination),
the Parties shall assign all Joint Collaboration Inventions and
Collaboration Inventions Patent Rights subject to Section 8.1.2 to
each Party in accordance with its relationship with the named
inventors. For example, patent applications and patents naming only
Dendreon employees as inventors shall be assigned to Dendreon.
***Confidential Treatment Requested
55
Similarly, patent applications and patents naming only Genentech
employees as inventors shall be assigned to Genentech. The
assignments in this Section 10.10 shall not limit the rights of
any Party resulting from any termination hereunder (for example,
in the event of breach under Section 10.6.1).
11. Confidentiality; Use of Names.
11.1 Confidential Information. In the course of this Agreement, either
or both Parties may disclose Confidential Information to the
other. The recipient of Confidential Information will use it only
for the purposes of this Agreement, and will not disclose it
except to its employees, consultants, or permitted sublicensees
and designees for such purposes. Each of the Parties will ensure
that its employees, consultants, or permitted sublicensees and
designees who receive access to the other Party's Confidential
Information are legally obligated to maintain the confidentiality
of such Confidential Information under terms at least as
restrictive as this Section 11.1, and each Party shall be
responsible for the compliance of its employees, consultants, or
permitted sublicensees and designees. Each Party represents to
the other that the terms of this Section 11.1 do not conflict
with any of the representing Party's obligations to any Third
Party.
11.2 Exceptions. The restrictions on use and disclosure of
Confidential Information shall not apply to information as to
which any of the following is true:
(a) the information is now, or hereafter becomes, through no act
or failure to act on the part of the recipient, generally
known or available to the public;
(b) the information is known by the recipient and evidenced by
written records before it receives the information from the
other Party;
(c) the information is furnished to the recipient by a Third
Party who did not acquire the information directly or
indirectly from the disclosing Party; or
(d) the information is independently developed by the recipient
without the use or knowledge of the Confidential
Information, as evidenced by written records.
11.3 Permitted Disclosure. A Party may disclose Confidential
Information received from the other Party if the information (i)
is necessary for any Regulatory Filing or to comply with
securities laws, regulations or guidances or (ii) is required by
law or by order of any court or governmental authority to be
disclosed by the recipient. In either case, the recipient may
disclose only the minimum Confidential Information required to be
disclosed and must take reasonable steps to obtain confidential
treatment for such information if such treatment is available. In
addition if disclosure is required by order of any court or
governmental authority, the recipient shall give the disclosing
party sufficient advance written notice to enable it to seek a
protective order or other remedy to protect such Confidential
Information.
11.4 Term of Confidentiality. Confidential Information shall be
maintained as confidential by the recipient for the Term of this
Agreement and for five (5) years thereafter.
56
11.5 Return of Information. Except with respect to Manufacturing
Know-How transferred to Dendreon under Sections 10.4.1, 10.4.2,
or 10.6.2, upon request of the disclosing Party the recipient
Party shall promptly return or destroy all written or recorded
material containing Confidential Information; provided, however,
that the recipient Party may retain one (1) copy of such
Confidential Information in a secure location solely for the
purpose of verifying compliance with its duties under this
Agreement.
11.6 Press Releases and Announcements. Promptly after the Effective
Date, Dendreon and Genentech may issue a press release announcing
this Agreement and the relationship of the Parties. Each Party
shall provide the other with a copy of any proposed press release
in advance of distribution and shall in good faith consider any
comments from such other Party. If the Parties issue a joint
press release, then both Parties must agree to the content of
such press release. Thereafter, press releases and like public
announcement concerning this Agreement or the activities
hereunder that contain information not previously disclosed to
the public shall be made only when, and in the form, approved by
the Parties; provided, however, if a press release or like public
announcement is required by law, regulation or court or
administrative order, the Parties shall, as is reasonably
practicable under the circumstances, consult with one another in
connection with such disclosure to allow the other Party an
opportunity to comment thereon.
11.7 Scientific Publications and Presentations. The JSC will establish
a publication policy ("Publication Policy") regarding the results
of the Product Development Program under this Agreement. Neither
Party shall publish or present such results in a manner that does
not comply with such Publication Policy. At a minimum, the
Publication Policy will require each Party to provide sufficient
time for the other Party to review any proposed manuscripts,
abstracts, posters or other materials proposed for publication or
presentation. Upon request, each Party agrees to delay any such
submission for a period sufficient to permit adequate steps to be
taken to prepare and file a patent application for any patentable
subject matter referred to therein. In addition, each Party
agrees to delete from any such proposed submission any
Confidential Information of the other Party upon its request.
12. General Provisions.
12.1 Future Acts. The Parties agree to execute and deliver all such
further instruments, and to do all such other acts, as may be
necessary or appropriate in order to carry out the intent and
purposes of this Agreement.
12.2 Independent Contractors. The Parties are and shall at all time be
independent contractors. In performing under this Agreement,
neither Party is an agent, employee, employer, joint venturer or
partner of the other. Neither Party shall incur or hold itself
out to Third Parties as having the authority to incur any
expenses, liabilities or obligations on behalf of the other
Party.
57
12.3 Assignment. This Agreement may be assigned in whole or in part as
follows:
(a) By Dendreon or Genentech to a successor by way of merger,
consolidation, or reorganization leading to succession involving
the transfer of all or substantially all of the assets and
businesses of the assigning Party to which this Agreement relates
so long as the assigning Party is the surviving corporation in
such merger, consolidation or reorganization.
(b) By Dendreon to a party (the "Acquiring Party") that is a
successor corporation resulting from any merger, consolidation or
reorganization of Dendreon with or into such corporation such
that Dendreon is not the surviving corporation or to a purchaser
of all or substantially all of Dendreon's stock or assets (the
"Acquisition Transaction"); provided that, in Genentech's
reasonable judgment, such Acquiring Party: (i) is not a party
with interests materially adverse to Genentech (for example,
without limitation, a party adverse to Genentech in significant
litigation, or a party commercializing or selling a product that
competes with a Genentech product) and (ii) has the scientific
staff, experience, laboratories and other facilities and assets
to carry out Dendreon's then-existing obligations under this
Agreement.
(c) By Dendreon to an Acquiring Party that does have the scientific
staff, experience, laboratories and other facilities and assets
to carry out Dendreon's then-existing obligations under this
Agreement but is a party with interests materially adverse to
Genentech, but only as follows:
(1) If the Acquisition Transaction closes prior to the approval
of the JSC to begin the first Phase I Clinical Trial
hereunder, such assignment of this Agreement may be made by
Dendreon to such Acquiring Party only with the prior written
consent of Genentech, which shall be in Genentech's sole
discretion.
(2) If the Acquisition Transaction closes after the approval of
the JSC to begin the first Phase I Clinical Trial hereunder
but before the FDA determines that the first Phase II
Clinical Trial is a Pivotal Trial or before the JSC
determines to proceed to the first Phase III Clinical Trial
hereunder, then, Dendreon may assign this Agreement with
Genentech's prior written consent, which shall not be
unreasonably withheld. If Genentech so consents, then upon
such assignment such Acquiring Party may elect to share
Profits and Losses as provided in Section 2.14 for the
Monoclonal Product and SM Product so long as it completes
the Phase I and II Clinical Trials for such Monoclonal
Product and SM Product in accordance with the Clinical Plan.
If the Acquiring Party does not complete such obligations as
described above, or does not elect to share Operating
Profits and Losses as provided in Section 2.14, then such
Acquiring Party shall be deemed to have elected to receive
the royalties provided in Section 6.5 on the terms provided
in Sections 6.7-6.12. If during the course of any Phase I
Clinical Trial or Phase II Clinical Trial conducted by such
Acquiring Party such Clinical Trial progress is delayed more
than six (6) months beyond the Clinical Plan timelines, then
Genentech shall have the right to step in and take full
responsibility for the conduct of, and complete, such
Clinical Trials. In such event, then such Acquiring Party
shall be deemed to have elected to receive the royalties
provided in Section 6.5 on the terms
58
provided in Sections 6.7-6.12. In no event shall such
Acquiring Party participate in the JSC or JPT after the
commencement of Phase III Clinical Trials nor have the right
to co-promote Licensed Products as provided in Section 7.2.
(3) If the Acquisition Transaction closes after the FDA
determines that the first Phase II Clinical Trial is a
Pivotal Trial or after the JSC determines to proceed to the
first Phase III Clinical Trial, Dendreon may assign this
Agreement to such Acquiring Party with Genentech's prior
written consent, which shall not be unreasonably withheld.
In such event, and if Dendreon has elected to share
Operating Profits and Losses for a Licensed Product as
provided in Section 2.14 prior to the closing of such
Acquisition Transaction, then the Acquiring Party shall also
have the right to share in Profits and Losses hereunder for
such Licensed Product. In no event will the Acquiring Party
have the right to participate on the JSC or JPT or the
opportunity to co-promote under Section 7.2 with respect to
any Licensed Product. With respect to Licensed Products, if
any, for which Dendreon has elected to receive the royalty
provided in Section 6.5, then the Acquiring Party shall also
receive such royalty on the terms and conditions provided in
Sections 6.7-6.12 in lieu of sharing in Operating Profits
and Losses.
(d) By Genentech to a successor in a transaction that does not fall
within the scope of Section 12.3(a) if such successor has the
expertise and scientific, commercial and financial capabilities
equivalent to or better than Genentech's at the time of the
execution of this Agreement.
(e) Except as provided above, this Agreement may not be assigned in
whole or in part without the express written consent of the
nonassigning Party which consent it may grant or refuse in its
sole discretion.
(f) This Agreement will be binding upon the successors and permitted
assigns of the Parties. Any assignment not in accordance with
this Section 12.3 will be void.
12.4 Waiver. No waiver by a Party in any one or more instances shall be
deemed to be a continuing waiver, a further waiver, a waiver of any
other provision of this Agreement, or a waiver of this Agreement as a
whole. No waiver of any right under this Agreement shall be effective
unless it is documented in writing signed by the Party providing the
waiver.
12.5 Force Majeure. A failure by a Party to perform any obligation under
this Agreement that is prevented by an occurrence beyond the control
of the non-performing Party (and which did not occur as a result of
its financial condition, negligence or fault), including acts of God,
embargoes, fires, floods, explosions, riots, wars, civil disorders,
terrorist acts, rebellion or acts of sabotage, shall not constitute a
breach of this Agreement so long as that Party notifies the other
Party as soon as practicable and uses its best efforts to resume
performance as soon as possible.
12.6 Severability. If any term of this Agreement is held invalid, illegal
or unenforceable in any jurisdiction, then, to the fullest extent
permitted by law (i) all other terms shall remain in full force and
effect in such jurisdiction, (ii) such invalidity, illegality or
59
unenforceability shall not affect the validity, legality or
enforceability of such provision in any other jurisdiction, and (iii)
the Parties shall negotiate such terms as may be necessary in good
faith in order to correct any imbalance of rights and obligations that
results from such invalidity, illegality or unenforceability in the
relevant jurisdiction.
12.7 Headings. All headings within this Agreement appear for convenience
only and shall not be used to construe, determine or interpret any
term of this Agreement.
12.8 Legal Counsel. Each Party is a sophisticated business entity which has
involved legal counsel in the drafting of this Agreement. Any
presumption or rule of interpretation disfavoring the drafter of an
agreement shall not apply to the interpretation and application of
this Agreement.
12.9 Dispute Resolution and Governing Law.
12.9.1 Disputes. The Parties recognize that disputes as to certain
matters may from time to time arise during the Term of this Agreement
which relate to either Party's contractual rights and/or obligations
hereunder. It is the objective of the Parties to establish procedures
to facilitate the resolution of disputes arising under this Agreement
in an expedient manner by mutual cooperation and without resort to
litigation. To accomplish this objective, the Parties agree to follow
the procedures set forth in this Section 12.9 if and when a dispute
arises under this Agreement.
Unless otherwise specifically recited in this Agreement, disputes
among members of the Joint Project Team will be resolved as recited in
this Section 12.9. Any disputes relating to the collaboration
hereunder shall be first referred to the JSC by either Party at any
time after such dispute has arisen and such Party believes that there
has been sufficient discussion of the matter at the Joint Project Team
level. If the JSC is unable to resolve such a dispute within sixty
(60) days of being requested by a Party to resolve the dispute or the
JSC is unable to resolve a dispute among its members, the matter shall
be presented to the chief executive officer of Genentech and Dendreon,
or their respective designee, for resolution. In the event that the
chief executive officer of Genentech and Dendreon, or their respective
designees, cannot resolve the dispute within thirty (30) days of being
requested by a Party to resolve a dispute, either Party may, by
written notice to the other, invoke the provisions of Section 12.9.2
below.
12.9.2 Arbitration. Subject to Section 12.9.3 below, the Parties agree
that any dispute, controversy or claim arising out of or relating to
this Agreement, or the breach, termination, or invalidity thereof,
shall be resolved through binding arbitration. If the dispute arises
between the Parties, and if such dispute cannot be resolved pursuant
to Section 12.9.1 above, any unresolved controversy or claim between
the Parties shall be resolved by binding arbitration in accordance
with the Commercial Arbitration Rules of the American Arbitration
Association as presently in effect, except as modified herein. Each
such arbitration shall be conducted by a panel of three arbitrators
appointed in accordance with the Commercial Arbitration Rules as
presently in effect; provided that at least one such arbitrator shall
have had, by the time of the actual arbitration, at least ten
60
(10) years of experience as an attorney and experience in the
pharmaceuticals industry so as to better understand the legal,
business and scientific issues addressed in the arbitral proceeding. A
reasoned arbitration decision shall be rendered in writing within
thirty (30) days of the conclusion of the arbitration hearing and
shall be binding. The prevailing Party may enter such decision in any
court having competent jurisdiction. Unless otherwise mutually agreed
upon by the Parties, the arbitration proceedings shall be conducted at
the location of the Party not originally requesting the resolution of
the dispute. Each Party must bear its own attorneys' fees and
associated costs and expenses. The arbitrators shall have the
authority to grant temporary and permanent injunctive and equitable
relief, including specific performance and to allocate costs between
the Parties (excluding attorney's fees).
12.9.3 Determination of Patents and Other Intellectual Property.
Notwithstanding the foregoing, the provisions of Sections 12.9.1 and
12.9.2 above shall not apply to any dispute, controversy or claim
relating to: (1) the determination of validity of claims, infringement
or claim interpretation relating to a Party's patents, trademarks or
copyright; or (2) any antitrust, anti-monopoly or competition law or
regulation, whether or not statutory.
12.9.4 Governing Law. This Agreement shall be governed by the law of
the State of New York, without giving effect to conflict of law
considerations.
12.10 Notices. A notice required or permitted under this Agreement shall be
in writing, addressed to a Party at the address listed below. Notices
may be (i) mailed within he United Stated registered or certified;
(ii) delivered in-person to the addressee; or (iii) delivered via
next-business day service by a well-established courier. All properly
addressed notices shall be deemed received three (3) business days
after the notice is placed in the hands of a Third Party for delivery.
A Party, by notice complying with this Section, may change its notice
address or addressee.
Notices to Dendreon: Notice to Genentech:
General Counsel Genentech, Inc.
Dendreon Corporation 1 DNA Way
▇▇▇▇ ▇▇▇▇▇ ▇▇▇▇▇▇ ▇▇▇▇▇ ▇▇▇ ▇▇▇▇▇▇▇▇▇, ▇▇ ▇▇▇▇▇
▇▇▇▇▇▇▇, ▇▇ ▇▇▇▇▇ Attn: Corporate Secretary
12.11 Amendment. This Agreement may be amended or modified only by a writing
signed by each of the Parties.
12.12 Entire Agreement. This Agreement and the Equity Investment Agreement
attached as Exhibit D, and the Confidentiality Agreement dated
September 13, 2001 between the Parties constitute the entire
understanding between the Parties as of the Effective Date with
respect to the subject matter hereof and thereof and supersede all
related prior or contemporaneous oral communications, agreements or
discussions with respect to the
61
subject matter hereof or thereof. Each of these agreements
must be read, interpreted, and applied in light of and with
the others. Together they constitute one, single business
transaction.
12.13 Counterparts. This Agreement may be executed simultaneously in
any number of counterparts, any one of which need not contain
the signature of more than one Party but all such counterparts
taken together will constitute one and the same agreement.
Dendreon Corporation Genentech, Inc.
By /s/ ▇▇▇▇▇▇▇▇ ▇. Gold, M.D. By /s/ ▇▇▇▇▇▇ ▇. ▇▇▇▇▇▇▇▇
---------------------------- -----------------------
▇▇▇▇▇▇▇▇ ▇. Gold, M.D. ▇▇▇▇▇▇ ▇. ▇▇▇▇▇▇▇▇
Chief Business Officer Chairman and Chief Executive Officer
62
Exhibit A
Trp-p8
aagaaaatcctgcttgacaaaaacctcacttaggaaaagatgtcctttcgggcagccgggctcagcatgaggaacagaag
gaat
gacactctggacagcacccggaccctgtactccagcgcgtctcggagcacagacttgtcttacagtgaaagcgacttggt
gaatt
ttattcaagcaaattttaagaaacgagaatgtgtcttctttaccaaagattccaaggccacggagaatgtgtgcaagtgt
ggctatg
cccagagccagcacatggaaggcacccagatcaaccaaagtgagaaatggaactacaagaaacacaccaaggaatttcct
ac
cgacgcctttggggatattcagtttgagacactggggaagaaagggaagtatatacgtctgtcctgcgacacggacgcgg
aaat
cctttacgagctgctgacccagcactggcacctgaaaacacccaacctggtcatttctgtgaccgggggcgccaagaact
tcgc
cctgaagccgcgcatgcgcaagatcttcagccggctcatctacatcgcgcagtccaaaggtgcttggattctcacgggag
gcac
ccattatggcctgacgaagtacatcggggaggtggtgagagataacaccatcagcaggagttcagaggagaatattgtgg
ccat
tggcatagcagcttggggcatggtctccaaccgggacaccctcatcaggaattgcgatgctgagggctattttttagccc
agtac
cttatggatgacttcacaagggatccactgtatatcctggacaacaaccacacacatttgctgctcgtggacaatggctg
tcatgg
acatcccactgtcgaagcaaagctccggaatcagctagagaagcatatctctgagcgcactattcaagattccaactatg
gtggc
aagatccccattgtgtgttttgcccaaggaggtggaaaagagactttgaaagccatcaatacctccatcaaaaataaaat
tccttgt
gtggtggtggaaggctcgggccggatcgctgatgtgatcgctagcctggtggaggtggaggatgccccgacatcttctgc
cgt
caaggagaagctggtgcgctttttaccccgcacggtgtcccggctgcctgaggaggagactgagagttggatcaaatggc
tca
aagaaattctcgaatgttctcacctattaacagttattaaaatggaagaagctggggatgaaattgtgagcaatgccatc
tcctacg
ctctatacaaagccttcagcaccagtgagcaagacaaggataactggaatgggcagctgaagcttctgctggagtggaac
cag
ctggacttagccaatgatgagattttcaccaatgaccgccgatgggagtctgctgaccttcaagaagtcatgtttacggc
tctcata
aaggacagacccaagtttgtccgcctctttctggagaatggcttgaacctacggaagtttctcacccatgatgtcctcac
tgaactc
ttctccaaccacttcagcacgcttgtgtaccggaatctgcagatcgccaagaattcctataatgatgccctcctcacgtt
tgtctgga
aactggttgcgaacttccgaagaggcttccggaaggaagacagaaatggccgggacgagatggacatagaactccacgac
gt
gtctcctattactcggcaccccctgcaagctctcttcatctgggccattcttcagaataagaaggaactctccaaagtca
tttggga
gcagaccaggggctgcactctggcagccctgggagccagcaagcttctgaagactctggccaaagtgaagaacgacatca
at
gctgctggggagtccgaggagctggctaatgagtacgagacccgggctgttgagctgttcactgagtgttacagcagcga
tga
agacttggcagaacagctgctggtctattcctgtgaagcttggggtggaagcaactgtctggagctggcggtggaggcca
cag
accagcatttcaccgcccagcctggggtccagaattttctttctaagcaatggtatggagagatttcccgagacaccaag
aactgg
aagattatcctgtgtctgtttattatacccttggtgggctgtggctttgtatcatttaggaagaaacctgtcgacaagca
caagaagct
gctttggtactatgtggcgttcttcacctcccccttcgtggtcttctcctggaatgtggtcttctacatcgccttcctcc
tgctgtttgcct
acgtgctgctcatggatttccattcggtgccacacccccccgagctggtcctgtactcgctggtctttgtcctcttctgt
gatgaagt
gagacagtggtacgtaaatggggtgaattattttactgacctgtggaatgtgatggacacgctggggcttttttacttca
tagcagg
aattgtatttcggctccactcttctaataaaagctctttgtattctggacgagtcattttctgtctggactacattattt
tcactctaagatt
gatccacatttttactgtaagcagaaacttaggacccaagattataatgctgcagaggatgctgatcgatgtgttcttct
tcctgttcct
ctttgcggtgtggatggtggcctttggcgtggccaggcaagggatccttaggcagaatgagcagcgctggaggtggatat
tccg
ttcggtcatctacgagccctacctggccatgttcggccaggtgcccagtgacgtggatggtaccacgtatgactttgccc
actgca
ccttcactgggaatgagtccaagccactgtgtgtggagctggatgagcacaacctgccccggttccccgagtggatcacc
atcc
ccctggtgtgcatctacatgttatccaccaacatcctgctggtcaacctgctggtcgccatgtttggctacacggtgggc
accgtcc
aggagaacaatgaccaggtctggaagttccagaggtacttcctggtgcaggagtactgcagccgcctcaatatccccttc
ccctt
catcgtcttcgcttacttctacatggtggtgaagaagtgcttcaagtgttgctgcaaggagaaaaacatggagtcttctg
tctgctgtt
tcaaaaatgaagacaatgagactctggcatgggagggtgtcatgaaggaaaactaccttgtcaagatcaacacaaaagcc
aac
gacacctcagaggaaatgaggcatcgatttagacaactggatacaaagcttaatgatctcaagggtcttctgaaagagat
tgctaa
taaaatcaaataaaactgtatgaaactctaatggagaaaaatctaattatagcaagatcatattaaggaatgctgatgaa
caattttg
ctatcgactactaaatgagagattttcagacccctgggtacatggtggatgattttaaatcaccctagtgtgctgagacc
ttgagaat
aaagtgtgtgattggtttcatacttgaagacggatataaaggaagaatatttcctttatgtgtttctccagaatggtgcc
tgtttctctct
gtgtctcaatgcctgggactggaggttgatagtttaagtgtgttcttaccgcctcctttttcctttaatcttatttttga
tgaacacatatat
aggagaacatctatcctatgaataagaacctggtcatgctttactcctgtattgttattttgttcatttccaattgattc
tctacttttccctt
ttttgtattatgtgactaattagttggcatattgttaaaagtctctcaaattaggccagattctaaaacatgctgcagca
agaggaccc
cgctctcttcaggaaaagtgttttcatttctcaggatgcttcttacctgtcagaggaggtgacaaggcagtctcttgctc
tcttggact
caccaggctcctattgaaggaaccacccccattcctaaatatgtgaaaagtcgcccaaaatgcaaccttgaaaggcacta
ctgac
tttgttcttattggatactcctcttatttattatttttccattaaaaataatagctggctattatagaaaatttagacca
tacagagatgtaga
aagaacataaattgtccccattaccttaaggtaatcactgctaacaatttctggatggtttttcaagtctattttttttc
tatgtatgtctca
attctctttcaaaattttacagaatgttatcatactacatatatactttttatgtaagctttttcacttagtattttatc
aaatatgtttttattatat
tcatagccttcttaaacattatatcaataattgcataataggcaacctctagcgattaccataattttgctcattgaagg
ctatctccagt
tgatcattgggatgagcatctttgtgcatgaatcctattgctgtatttgggaaaattttccaaggttagattccaataaa
tatctatttatt
attaaatattaaaatatcgatttattattaaaaccatttataaggctttttcataaatgtatagcaaataggaattatta
acttgagcataa
gatatgagatacatgaacctgaactattaaaataaaatattatatttaaccctagtttaagaagaagtcaatatgcttat
ttaaatattat
ggatggtgggcagatcacttgaggtcaggagttcgagaccagcctggccaacatggcaaaaccacatctctactaaaaat
aaaa
aaattagctgggtgtggtggtgcactcctgtaatcccagctactcagaaggctgaggtacaagaattgctggaacctggg
aggc
ggaggttgcagtgaaccaagattgcaccactgcactccagccggggtgacagagtgagactccgactgaaaataaataaa
taa
ataaataaataaataaataaataaatattatggatggtgaagggaatggtatagaattggagagattatcttactgaaca
cctgtagt
cccagctttctctggaagtggtggtatttgagcaggatgtgcacaaggcaattgaaatgcccataattagtttctcagct
ttgaatac
actataaactcagtggctgaaggaggaaattttagaaggaagctactaaaagatctaatttgaaaaactacaaaagcatt
aactaa
aaaagtttattttccttttgtctgggcagtagtgaaaataactactcacaacattcactatgtttgcaaggaattaacac
aaataaaag
atgcctttttacttaaacgccaagacagaaaacttgcccaatactgagaagcaacttgcattagagagggaactgttaaa
tgttttca
acccagttcatctggtggatgtttttgcaggttactctgagaattttgcttatgaaaaatcattatttttagtgtagttc
acaataatgtatt
gaacatacttctaatcaaaggtgctatgtccttgtgtatggtactaaatgtgtcctgtgtacttttgcacaactgagaat
cctgcggctt
ggtttaatgagtgtgttcatgaaataaataatggaggaattgtcaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
aaaaa
aaaaaaaaaaaaaaaaaaaaaaaa
Exhibit B
FINANCIAL PLANNING, ACCOUNTING AND REPORTING
FOR THE DENDREON/GENENTECH
COLLABORATIVE DEVELOPMENT AND MARKETING AGREEMENT
This Exhibit B to the Collaborative Development and Marketing Agreement (the
"Agreement") made as of August 1, 2002 between Dendreon Corporation ("Dendreon")
and Genentech, Inc. ("Genentech") covers financial planning, accounting policies
and procedures to be followed in determining DENDREON/GNE Development Costs and
Operating Profits or Losses pursuant to the Agreement.
For such purpose, this Exhibit B sets forth the principles for reporting actual
results and budgeted plans of the combined operations in the United States, the
frequency of reporting, the methods of determining payments to the Parties,
auditing of accounts and other matters.
For purposes of this Exhibit B only, the consolidated accounting of operations
for the collaboration of the Parties hereunder shall be referred to as the
"Collaboration." The Collaboration is not a legal entity, pass through or
otherwise, for financial accounting, income tax reporting, or any other
purposes, and has been defined for identification purposes only.
This Exhibit B also provides agreed upon definitions of financial terms
applicable to the Parties for purposes of the Agreement; provided, however, that
the definition of "Fully Burdened Manufacturing Costs" shall apply to Genentech,
to the extent it manufactures any Licensed Product under the Agreement or to
Dendreon if Dendreon becomes responsible for manufacturing under the Agreement
or either of the supply agreements referred to in the Agreement. The definition
of "DENDREON/GNE Development Costs" shall apply to the development work by both
Parties to the extent to be shared under this Exhibit B pursuant to the terms of
the Agreement. All capitalized terms used herein without definition shall have
the meanings ascribed thereto in the Agreement, unless otherwise expressly
provided herein. References in this Exhibit B to a "Party" or "Parties" shall be
construed to mean Genentech or Dendreon, as the case may be, and in every case
shall be deemed to include a Party's permitted sublicensees and assigns as
applicable under the Agreement.
The contents of this Exhibit B are hereby incorporated into the Agreement and
are governed by the terms and conditions of the Agreement, including, without
limitation, the confidentiality provisions set forth therein.
B.1 Principles of Reporting. With respect to each Monoclonal Product or SM
Product, including the first and any Additional Product, and with respect to
each New Molecule, the Parties will share DENDREON/GNE Development Costs,
[...***...] to Dendreon and [...***...] to Genentech. Until the first commercial
sale of the first Licensed Product in the United States, expenses to be shared
by the Parties hereunder shall largely be reported as DENDREON/GNE Development
Costs. Commencing with the commercial sale of the first Licensed Product in the
United States, the Parties will report their respective results of operations in
the United States based on each Party's respective financial information
presented separately and on a consolidated basis in the reporting format
depicted below and will share the resulting Operating Profit and Loss
[...***...] to Dendreon and [...***...] to Genentech:
Dendreon Genentech Total
-------- --------- -----
Gross Sales
less Sales Returns and Allowances
= Net Sales
less Cost of Sales
= Gross Profits
less Marketing Costs
less Sales Costs
less DENDREON/GNE Development Costs
less Other Operating Income/Expense
less Distribution Costs
less General and Administrative Costs
= Operating Profit (Loss)
It is the intention of the Parties that the interpretation of the definitions in
this Exhibit B will be consistent with generally accepted accounting principles
("GAAP") in the United States.
If necessary, a Party will make the appropriate adjustments to the financial
information it supplies under the Agreement to conform to the above format of
reporting results of operations. The JSC will approve the balancing payments
necessary to achieve the agreed-upon sharing of Operating Profit and Loss
pursuant to the Agreement.
B.2 Frequency of Reporting.
The fiscal year of the Collaboration will be a calendar year.
***Confidential Treatment Requested
Reporting by each Party for Collaboration revenues and expenses will be
performed as follows:
Reporting Event Frequency Timing of Submission
--------------- --------- --------------------
Actuals (including draft Quarterly Q1-Q3: +45 days
settlement statements) Q4: +45 days
Forecasts Quarterly Q1-Q3 +60 days
(rest of year - by month)
Settlement payments between
the Parties Quarterly Quarter end +60 days
Preliminary Budgets Annually September 15
(one year)
Final Combined Commercial Annually October 15
And Development Budget
(one year - by quarter)
Long Range Plan Annually April 15
(current year plus 5 years)
Reports of actual results compared to budget will be made by the Parties to the
Joint Project Team on a quarterly basis. After approval by the Joint Project
Team as to amounts, the Joint Project Team will forward the report to the JSC
for its approval. Variances from the total overall budgets, and significant
variances in budget line items for DENDREON/GNE Development Costs and other
costs or revenue line items, will be included in the calculation of Operating
Profits and Losses only when approved by the JSC.
Genentech will be responsible for the preparation of consolidated reporting of
the Collaboration (including DENDREON/GNE Development Costs and any Operating
Profit or Loss), calculation of the sharing and initial determination of the
cash settlement (subject to approval by the JSC). Within forty-five (45) days of
each quarter end, Genentech will provide the financial representatives from each
Party with a statement showing the consolidated results and calculations of the
Operating Profit or Loss sharing (or calculation of expenses to be shared) and
cash settlement required in a format substantially as depicted above.
Genentech shall record sales in the United States. On a monthly basis, Genentech
will supply Dendreon with each month's Gross Sales and Net Sales of Licensed
Products in units and U.S. dollars in the United States. Each such report shall
be provided as early as possible, but no later than ten (10) days after the last
day of the month in question, and shall provide monthly and year-to-date
cumulative figures.
The financial representatives from the Parties
will meet as appropriate but at least quarterly
to review and approve the following:
- DENDREON/GNE Development Costs
- Costs of Sales and other costs
- actual results
- forecasts
- budgets
- inventory levels
- Sales Returns and Allowances
- other financial matters, including each
Party's methodologies for charging costs to
the Collaboration, for determination of
actuals, forecasts, budgets and long range
plans and the results of applying such
methodologies.
B.3 Budget and Commercialization Plans.
Budgets will be prepared annually. Responsibility for the Clinical Plans,
Commercialization Plans and their related budgets will rest with the Joint
Project Team (except for Preclinical Programs), subject to final approval by the
JSC, in accordance with the Agreement.
Budgets under this Exhibit B will be supplemented with detailed business plans
for clinical trials, drug approval applications, and overall strategy plans for
product introduction, sales and promotion efforts, as determined by the Joint
Project Team in accordance with the Agreement. Budgets, once approved by the
JSC, can only be changed with the approval of the JSC, as provided in the
Agreement.
The Joint Project Team, with the assistance of the financial representatives of
each Party, will be responsible for identifying, analyzing and reporting all
significant line item budget variances and all overall, total budget variances.
Except as provided otherwise in the Agreement, only the JSC may approve
materially unfavorable line item budget variations, as defined by the Joint
Project Team, and all overall, total budget variations, chargeable to the
Collaboration during the course of the year.
A five (5)-year Commercialization Plan for the Collaboration will be established
on a yearly basis under the direction of the JSC and submitted to Genentech and
Dendreon by April 15 each year.
B.4 Definitions.
B.4.1 "Allocable Overhead" means costs incurred by a Party or for its account
which are attributable to a Party's supervisory services, occupancy
costs, corporate cash bonus (to the extent not charged directly to
department), and its payroll, information systems, human relations or
purchasing functions and which are
allocated to company departments based on space occupied or headcount
or other activity-based method consistently applied by a Party, or a
standard rate if agreed to by the Parties. Allocable Overhead shall not
include any costs attributable to general corporate activities
including, by way of example, executive management, investor relations,
business development, legal affairs and finance, and shall not
duplicate G&A hereunder.
B.4.2 "Cost of Sales" shall mean the sum of (i) Fully Burdened Manufacturing
Cost (as defined below), (ii) freight, insurance and other costs of
shipping Licensed Product to customers, (iii) any Third Party royalties
payable with respect to the manufacture, use or sale of Licensed
Product, excluding any royalties already accounted for in Fully
Burdened Manufacturing Cost, and (iv) the cost of free Licensed Product
for indigent persons.
B.4.3 "DENDREON/GNE Development Costs" means the development costs incurred
(including accruals) by Genentech or Dendreon to be shared pursuant to
the terms of the Agreement, from the Effective Date of the Agreement
through the later of (a) the date of Regulatory Approval (including
thereafter costs to maintain or expand such Regulatory Approval) in the
United States, or (b) the date of termination of development efforts of
the final indication for which Regulatory Approval is sought in the
United States. Such costs shall comprise those costs required to
obtain, maintain and/or expand the authorization and/or ability to
manufacture, formulate, fill, ship and/or sell a Licensed Product in
commercial quantities to Third Parties in the United States.
"DENDREON/GNE Development Costs" shall include, but are not limited to,
costs of development including costs of studies (but only to the extent
to be shared pursuant to the terms of the Agreement) on the
toxicological, pharmacokinetical, metabolical or clinical aspects of a
Licensed Product conducted internally, or by individual investigators
or consultants, necessary for the purpose of obtaining, maintaining
and/or expanding marketing approval of a Licensed Product, process
development, process improvement and recovery costs, qualification
lots, costs for preparing, submitting, reviewing or developing data or
information for the purpose of submission to a Regulatory Agency to
obtain, maintain and/or expand marketing approval of a Licensed Product
in the United States, and applicable Allocable Overhead.
"DENDREON/GNE Development Costs" shall include expenses for data
management, CROs, statistical designs and studies, document
preparation, and other administration expenses associated with the
clinical testing program or post-marketing studies required to maintain
product approvals. In determining "DENDREON/GNE Development Costs"
chargeable under this Agreement, each Party will use its respective
project accounting systems, and will review and approve its respective
project accounting systems and methodologies with the other Party.
"DENDREON/GNE Development Costs" shall include all Preclinical Program
Costs and Clinical Trial Costs for Phase I, II and III Clinical Trials
for Additional Products and New Molecules.
B.4.4 "Distribution Costs" means the costs, including applicable Allocable
Overhead, specifically identifiable to the distribution of a Licensed
Product by a Party including customer services, collection of data
about sales to hospitals and other end users, order entry, billing,
credit and collection and other such activities. For the purpose of
this Agreement, Genentech will charge the Collaboration for
Distribution Costs an amount equal to [...***...] of Net Sales in any
year.
B.4.5 "Fully Burdened Manufacturing Cost" means one hundred percent (100%) of
a Party's manufacturing cost (as defined in the manufacturing Party's
accounting policies consistently applied), which shall comprise the sum
of:
(a) the cost of goods produced as determined by the Party
manufacturing or contracting with a Third Party for each stage
of the manufacturing process in accordance with GAAP
consistently applied by such Party, including without
limitation labor and material cost, product quality
assurance/control costs, applicable Allocable Overhead, and
other costs borne by the Party for transport, customs
clearance and storage of product at the request of the other
Party prior to the time of sale (i.e. freight, customs, duty
and insurance); and
(b) all of the Party's allocable intellectual property acquisition
and licensing costs (including royalties) paid to Third
Parties as it relates to the manufacture of Licensed Product.
For purposes of this Exhibit B, the amount to be charged to the
Collaboration for Clinical Supply and Commercial Supply of Monoclonal
Product under the Agreement shall be Genentech's Fully Burdened
Manufacturing Cost plus [...***...] of such Fully Burdened
Manufacturing Cost. The amount to be charged to the Collaboration for
Clinical Supply and Commercial Supply of SM Product under the Agreement
when manufactured by Genentech shall be Genentech's Fully Burdened
Manufacturing Cost plus [...***...] of such Fully Burdened
Manufacturing Cost, and when manufactured by a Third Party contract
manufacturer the amount charged shall be the Third Party manufacturing
contracted cost plus [...***...] of such Third Party manufacturing
contracted cost. Either Party holding inventory for commercial sales
shall be permitted to ▇▇▇▇ the collaboration a reasonable and customary
carrying charge to compensate it for its financing and logistical
product support, which amount shall be further defined and agreed upon
in the Commercial Supply Agreement between the Parties.
B.4.6 "General and Administrative Costs" means costs chargeable to the
Collaboration equal to [...***...] of the sum of the Marketing Costs,
Sales Costs, and DENDREON/GNE Development Costs of either Genentech and
of Dendreon, but only to the extent these costs are chargeable to the
Collaboration.
***Confidential Treatment Requested
B.4.7 "Gross Profit" means Net Sales less Cost of Sales of a Licensed
Product by a Party to Third Parties in the United States.
B.4.8 "Gross Sales" means the gross amount invoiced by either Party, and/or
their permitted sublicensees for sales of a Licensed Product to Third
Parties in the United States.
B.4.9 "Marketing Costs" means the direct costs of marketing, promotion,
advertising, Licensed Product promotional materials, professional
education, product related public relations, relationships with
opinion leaders and professional societies, market research (before
and after product approval), healthcare economics studies,
post-marketing studies not required to maintain product approvals, and
other similar activities related to the Licensed Products. Such costs
will include internal costs (e.g., salaries, benefits, travel,
supplies and materials, etc.), applicable Allocable Overhead, and
outside services and expenses (e.g., consultants, agency fees, meeting
costs, etc.). "Marketing Costs" shall also include activities related
to obtaining reimbursement from payers and costs of sales and
marketing data. "Marketing Costs" will specifically exclude the costs
of activities which promote either Party's business as a whole without
being product specific (such as corporate image advertising).
B.4.10 "Net Sales" means Gross Sales of a Licensed Product less applicable
Sales Returns and Allowances.
B.4.11 "Operating Profits or Losses" means Net Sales of all Licensed Products
less the following items with respect to each Product, all for a given
period: Cost of Sales, Marketing Costs, Sales Costs, DENDREON/GNE
Development Costs (to the extent chargeable to the Collaboration),
General and Administrative Costs, Distribution Costs, and Other
Operating Income/Expense.
B.4.12 "Other Operating Income/Expense" means other operating income or
expense from or to Third Parties which is not part of the primary
business activity of the Collaboration, but is designated as such in
the Agreement or considered and approved by the Joint Project Team and
the JSC as income or expense for purposes of the Collaboration and
including the following:
- actual inventory write-offs of any Licensed Product
- trademark infringement recoveries (as provided in Section
7.8 of the Agreement)
- product liability insurance to the extent the Parties obtain
a joint policy
patent infringement expenses and recoveries as provided in
Sections 8.6.6 and 8.7
- other (to be approved by JSC)
B.4.13 "Trademark Costs" means the fees and expenses paid to outside legal
counsel and experts, and filing and maintenance expenses, incurred
after the Effective Date to establish and maintain Licensed Product
Trademarks, to the extent chargeable to the Collaboration.
B.4.14 "Sales Costs" means costs, including Allocable Overhead, approved by
the Joint Steering Committee with the annual budget, incurred by the
Parties or for their account and specifically identifiable to the
sales efforts of Licensed Products to all markets in the United
States, including, without limitation, the managed care market. "Sales
Costs" shall include costs associated with sales representatives for
Licensed Product, including compensation, benefits and travel,
supervision and training of the sales representatives, sales meetings,
and other sales expenses. "Sales Costs" will not include the start-up
costs associated with either Party's sales force, including
recruiting, relocation and other similar costs.
B.4.15 "Sales Returns and Allowances" means the sum of (a) and (b), where:
(a) is a provision, determined by a Party under GAAP for sales of
Licensed Products in the Unites States for (i) trade, cash and
quantity discounts or rebates on Licensed Products (other than price
discounts granted at the time of invoicing and which are included in
the determination of Gross Sales), (ii) credits or allowances given or
made for rejection or return of, and for uncollectable amounts on,
previously sold Licensed Products or for retroactive price reductions
(including Medicare and similar types of rebates and chargebacks),
(iii) taxes (excluding local, state, or federal incomes taxes on the
income of a Party), duties or other governmental charges levied on or
measured by the billing amount for Licensed Products, as adjusted for
rebates and refunds, (iv) charges for freight and insurance directly
related to the distribution of Licensed Products, to the extent
included in Gross Sales, (v) credits for allowances given or made for
wastage replacement, and (vi) other special sales programs agreed to
by the Parties for Licensed Products; and (b) is a periodic adjustment
of the provision determined in (a) to reflect amounts actually
incurred by a Party in the United States for items (i), (ii), (iii),
(iv), (v) and (vi) in clause (a). The provision allowed in clause (a)
and adjustments made in clause (b) (if any) will be reviewed and
approved by the financial representatives of the Parties.
B.5 Audits and Interim Reviews.
Either Party shall have the right to request that its independent accounting
firm perform an audit of the other Party's books of accounts, no more than once
every calendar year, for the sole purpose of verifying compliance with this
Agreement. Such audits may include, without limitation the reporting and
accounting for accruals and testing of a Party's algorithms and systems for
determining Allocable Overhead. Only one audit will be conducted with respect to
any given set of financial transactions supporting the income statement for the
collaboration for any given year. In such audit the firm may review books of
accounts covering no more than the two (2) years just prior to such audit. Such
audits will be conducted at the expense of the requesting Party and with thirty
(30) days prior written notice to the other Party. The audited Party shall have
the right to
participate in scope determination in accordance with generally accepted
auditing standards. Audit results will be shared with both Parties. If
accounting errors are found which exceed an overall net of five percent (5%) or
more of the total due such that the Party being audited has been overpaid by
five percent (5%) or more, then the costs of such audit shall be borne by the
Party being audited. Any overpayment or underpayment will be settled within
thirty (30) days after receipt of the audit results by the Party required to
make the balancing payment
B.6 Payments between the Parties.
Payments to each Party of the agreed upon percentages of Operating Profit or
Loss as provided under Section B.9 below will be made quarterly, based on actual
results within sixty (60) days after the end of each quarter. A report, as
approved by the JSC, specifying how each payment was calculated shall also be
submitted with each payment to both Parties. Balancing payments by one Party to
reimburse the other Party for purposes of the sharing of Operating Loss,
including DENDREON/GNE Development Costs, under the Agreement will be approved
by the JSC and shall be made within sixty (60) days of receipt of the approved
JSC report. In the event any payment is made after the time period specified
herein, the paying Party shall increase the amount otherwise due and payable by
adding interest thereon, computed at the Prime Rate plus [...***...]. Genentech
will perform the consolidation and settlement calculations for submission to the
JSC.
B.7 Responsibility for Reporting.
The responsibility for the consolidated reporting of the Collaboration to the
JSC shall be with Genentech in close cooperation with Dendreon and the financial
representatives of the Parties. This will be the basis for Collaboration
accounting and determining of payments to the Parties. Genentech shall provide
Dendreon with a copy of the Collaboration consolidated reporting and the
calculation serving as the basis of determining payments to the Parties.
Dendreon will provide Genentech with financial statements within thirty (30)
days after the end of the quarter for its activities in the United States,
prepared in accordance with the terms contained in this Exhibit B in order for
Genentech to prepare the consolidated reports.
B.8 Accounting for DENDREON/GNE Development Costs, Marketing Costs and
Sales Costs.
All DENDREON/GNE Development Costs, Marketing Costs and Sales Costs will be
based on the appropriate costs definition stated in Section B.4 of this Exhibit
B.
Each Party shall report DENDREON/GNE Development Costs within thirty (30) days
after the end of each quarter in a manner consistent with its project cost
system. In general, these project cost systems report actual time spent on
specific projects, apply the actual labor costs, capture actual costs of
specific projects and allocate other expenses to projects.
***Confidential Treatment Requested
For Marketing and Sales Costs, Genentech (and Dendreon if Dendreon markets
Licensed Product pursuant to the Agreement) will report costs based on internal
and external spending in Marketing and Sales departments. The Parties
acknowledge that the methodologies used will be based on systems in place.
B.9 Operating Profits and Loss Sharing.
Genentech and Dendreon agree to share the Operating Profit or Loss in the
Territory resulting from the Agreement in the following manner:
(a) Genentech shall be allocated [...***...] of the Operating Profits
or Losses from the sale of Licensed Products and
(b) Dendreon shall be allocated [...***...] of the Operating Profits or
Losses from the sale of Licensed Products.
B.10 Development Cost Sharing.
Genentech and Dendreon agree to share the DENDREON/GNE Development Costs in the
United States, to the extent shared pursuant to the terms of the Agreement, as
provided in Section 2.14 of the Agreement and this Exhibit B.
B.11 Start of Operations and Effective Accounting Date Termination.
Operation of the Collaboration will be deemed to have commenced as of the date
that Dendreon gives Genentech written notice of its election, in accordance with
Section 2.14 of the Agreement, to participate in the sharing of DENDREON/GNE
Development Costs and Profits and Losses hereunder. Costs and expenses incurred
prior to such date are not chargeable to the Collaboration under this Exhibit B.
For reporting and accounting purposes with respect to the Collaboration, the
effective termination date of the Agreement with regard to the last detailing
year in the United States will be the nearest month end to which such
termination takes place.
***Confidential Treatment Requested
Exhibit C
Itakura/▇▇▇▇▇ Patents
The patents listed below are the "Itakura/▇▇▇▇▇ Patents." The Itakura/▇▇▇▇▇
Patents shall mean any of the U.S. patents listed below and any and all
divisionals, continuations, continuations-in-part, reissues, reexaminations or
extensions of these patents or of any application from which these U.S patents
claim priority, as well as foreign counterparts of the foregoing.
U.S. 4,356,270
U.S. 4,366,246
U.S. 4,425,437
U.S. 4,431,739
U.S. 4,563,424
U.S. 4,571,421
U.S. 4,704,362
U.S. 4,812,554
U.S. 5,221,619
U.S. 5,420,020
U.S. 5,583,013